Transcript: Human NR_027154.1

Homo sapiens SMG1 pseudogene 1 (SMG1P1), non-coding RNA.

Source:
NCBI, updated 2018-05-10
Taxon:
Homo sapiens (human)
Gene:
SMG1P1 (641298)
Length:
5010
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027154.1
NBCI Gene record:
SMG1P1 (641298)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027154.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244935 CTCGATGTTACCCTCATATTT pLKO_005 1301 3UTR 100% 15.000 7.500 Y SMG1 n/a
2 TRCN0000082411 GCCACCAAAGACATGAGGAAA pLKO.1 778 3UTR 100% 4.950 2.475 Y NPIPB4 n/a
3 TRCN0000183297 GCTTGAAGAATATTCCTGTTT pLKO.1 2050 3UTR 100% 4.950 2.475 Y BOLA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027154.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488255 ACGTTGGAAAGGGAAAGCTGGCTT pLX_317 1.7% 38.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_10398 pDONR223 100% 9.3% None (many diffs) n/a
3 ccsbBroad304_10398 pLX_304 0% 9.3% V5 (many diffs) n/a
4 TRCN0000474199 GATTATACATTTATGTAATCCGTA pLX_317 93.9% 9.3% V5 (many diffs) n/a
Download CSV