Transcript: Human NR_027253.1

Homo sapiens BASP1 antisense RNA 1 (BASP1-AS1), long non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
BASP1-AS1 (285696)
Length:
3316
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027253.1
NBCI Gene record:
BASP1-AS1 (285696)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027253.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164045 CGTTCACTTTGCTTACCTGTT pLKO.1 974 3UTR 100% 4.050 5.670 N BASP1-AS1 n/a
2 TRCN0000165142 GCGTTCACTTTGCTTACCTGT pLKO.1 973 3UTR 100% 2.640 3.696 N BASP1-AS1 n/a
3 TRCN0000165877 GTTGGCAAGAGGGACATACAA pLKO.1 992 3UTR 100% 5.625 3.938 N BASP1-AS1 n/a
4 TRCN0000163045 GCAGAACAGTTTCAGTCGATT pLKO.1 1436 3UTR 100% 4.950 3.465 N BASP1-AS1 n/a
5 TRCN0000166069 GCTTTAATGGAGGCCACCAAT pLKO.1 797 3UTR 100% 4.950 3.465 N BASP1-AS1 n/a
6 TRCN0000162867 GTAGGAAGATGCGTTCACTTT pLKO.1 963 3UTR 100% 4.950 3.465 N BASP1-AS1 n/a
7 TRCN0000163134 GAAGATGCGTTCACTTTGCTT pLKO.1 967 3UTR 100% 3.000 2.100 N BASP1-AS1 n/a
8 TRCN0000163084 GCACTACCTTTATGAGCTGTA pLKO.1 2721 3UTR 100% 4.050 2.025 Y BASP1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027253.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10610 pDONR223 100% 17% None 1_448del;1016_3316del n/a
2 ccsbBroad304_10610 pLX_304 0% 17% V5 1_448del;1016_3316del n/a
3 TRCN0000477248 GTCCTAATACATTCGCAAGGCCTT pLX_317 52.7% 17% V5 1_448del;1016_3316del n/a
Download CSV