Transcript: Human NR_027379.1

Homo sapiens long intergenic non-protein coding RNA 1555 (LINC01555), long non-coding RNA.

Source:
NCBI, updated 2019-07-15
Taxon:
Homo sapiens (human)
Gene:
LINC01555 (439927)
Length:
2884
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027379.1
NBCI Gene record:
LINC01555 (439927)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027379.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183098 CGTGGAATAATCAAAGCAAAT pLKO.1 2109 3UTR 100% 10.800 8.640 N LINC01555 n/a
2 TRCN0000180003 CCTGCAAGTATCCAGAGAGTT pLKO.1 2453 3UTR 100% 4.950 3.465 N LINC01555 n/a
3 TRCN0000183253 GTTTATTTCTAGCTATGCTGT pLKO.1 418 3UTR 100% 2.640 1.848 N LINC01555 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027379.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10636 pDONR223 100% 12.7% None 1_128del;498_2884del n/a
2 ccsbBroad304_10636 pLX_304 0% 12.7% V5 1_128del;498_2884del n/a
3 TRCN0000478112 AAATGAGCGGATGTCTTTCCAACC pLX_317 90% 12.7% V5 1_128del;498_2884del n/a
Download CSV