Transcript: Human NR_027420.1

Homo sapiens ankyrin repeat domain 57 pseudogene (LOC389834), non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
LOC389834 (389834)
Length:
8205
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027420.1
NBCI Gene record:
LOC389834 (389834)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027420.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159358 GAGGTTTATATTCTGGGTATT pLKO.1 3910 3UTR 100% 10.800 8.640 N LOC389834 n/a
2 TRCN0000160653 CTAAGGTTTGTCTTCTGAAAT pLKO.1 2051 3UTR 100% 13.200 9.240 N LOC389834 n/a
3 TRCN0000163702 GCCATGCAAAGGAAGGAATAT pLKO.1 2652 3UTR 100% 13.200 9.240 N LOC389834 n/a
4 TRCN0000165169 GAAGCTGCTAGTGGGAACATA pLKO.1 1532 3UTR 100% 5.625 3.938 N LOC389834 n/a
5 TRCN0000166767 CCCACTCTCCATGATGTGATT pLKO.1 3431 3UTR 100% 4.950 3.465 N LOC389834 n/a
6 TRCN0000162832 CGCTCTCTTAAAGTCCACTTA pLKO.1 1962 3UTR 100% 4.950 3.465 N LOC389834 n/a
7 TRCN0000161414 GCTAAGGTTTGTCTTCTGAAA pLKO.1 2050 3UTR 100% 4.950 3.465 N LOC389834 n/a
8 TRCN0000160285 CCTATGGTACTTTGAAATGAA pLKO.1 3837 3UTR 100% 5.625 3.375 N LOC389834 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6361 3UTR 100% 4.950 2.475 Y KAAG1 n/a
10 TRCN0000147329 GTTCTCACTTATTTGTGGGAT pLKO.1 3186 3UTR 100% 2.640 1.320 Y NXNL2 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2463 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 6426 3UTR 100% 4.950 2.475 Y ERN2 n/a
13 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 6426 3UTR 100% 4.950 2.475 Y P3H4 n/a
14 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 6426 3UTR 100% 4.950 2.475 Y P3H4 n/a
15 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 6428 3UTR 100% 4.950 2.475 Y CFLAR n/a
16 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 6428 3UTR 100% 4.950 2.475 Y C19orf31 n/a
17 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2463 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027420.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10623 pDONR223 100% 8.8% None 1_835del;1565_8205del n/a
2 ccsbBroad304_10623 pLX_304 0% 8.8% V5 1_835del;1565_8205del n/a
3 TRCN0000477103 CGCCAACAAGCAGGGGTACTCGTG pLX_317 47.4% 8.8% V5 1_835del;1565_8205del n/a
Download CSV