Transcript: Human NR_027503.1

Homo sapiens glucuronidase beta pseudogene (LOC100133050), non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
LOC100133050 (100133050)
Length:
701
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027503.1
NBCI Gene record:
LOC100133050 (100133050)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027503.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140881 GATCTCCGTCAAGTGCAGTAA pLKO.1 43 3UTR 100% 4.950 2.475 Y GUSBP15 n/a
2 TRCN0000155455 GATCTCCGTCAAGTGCAGTAA pLKO.1 43 3UTR 100% 4.950 2.475 Y GUSBP2 n/a
3 TRCN0000063787 TCAAGTTGGAAGTGTGTCTTT pLKO.1 69 3UTR 100% 4.950 2.475 Y GUSBP14 n/a
4 TRCN0000063783 CGTCAAGTGCAGTAACCAGTT pLKO.1 49 3UTR 100% 4.050 2.025 Y GUSBP14 n/a
5 TRCN0000139416 CGTCAAGTGCAGTAACCAGTT pLKO.1 49 3UTR 100% 4.050 2.025 Y GUSBP15 n/a
6 TRCN0000155992 CGTCAAGTGCAGTAACCAGTT pLKO.1 49 3UTR 100% 4.050 2.025 Y GUSBP2 n/a
7 TRCN0000141828 GAATTACCAGATCTCCGTCAA pLKO.1 34 3UTR 100% 4.050 2.025 Y GUSBP15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027503.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00710 pDONR223 100% 25.9% None (many diffs) n/a
2 ccsbBroad304_00710 pLX_304 0% 25.9% V5 (many diffs) n/a
3 TRCN0000481467 GCCCAGACCTGGCCCATATGTCAG pLX_317 28.2% 25.9% V5 (many diffs) n/a
Download CSV