Transcript: Human NR_027634.1

Homo sapiens shieldin complex subunit 2 pseudogene 3 (SHLD2P3), transcript variant 1, non-coding RNA.

Source:
NCBI, updated 2019-01-26
Taxon:
Homo sapiens (human)
Gene:
SHLD2P3 (439965)
Length:
3294
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027634.1
NBCI Gene record:
SHLD2P3 (439965)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027634.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294286 CTAAACATCAGCCAGATATAT pLKO_005 461 3UTR 100% 15.000 7.500 Y SHLD2 n/a
2 TRCN0000307296 ATACTGTGTTCCCAACTAAAT pLKO_005 1094 3UTR 100% 13.200 6.600 Y SHLD2 n/a
3 TRCN0000062793 GCCCATTTGTTCACTGTATTT pLKO.1 2786 3UTR 100% 13.200 6.600 Y SHLD2 n/a
4 TRCN0000294287 TTTCGCTTATCCCTACCTAAA pLKO_005 2886 3UTR 100% 10.800 5.400 Y SHLD2 n/a
5 TRCN0000062797 CCTGTAAATAAAGGGAATGTA pLKO.1 797 3UTR 100% 5.625 2.813 Y SHLD2 n/a
6 TRCN0000062794 CGGACCAAATTCTGGCTCTAA pLKO.1 1388 3UTR 100% 4.950 2.475 Y SHLD2 n/a
7 TRCN0000062796 CCCAGAAGATTCACTCCTCTA pLKO.1 318 3UTR 100% 4.050 2.025 Y SHLD2 n/a
8 TRCN0000286879 CCCAGAAGATTCACTCCTCTA pLKO_005 318 3UTR 100% 4.050 2.025 Y SHLD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027634.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03431 pDONR223 100% 74.7% None (many diffs) n/a
2 ccsbBroad304_03431 pLX_304 0% 74.7% V5 (many diffs) n/a
Download CSV