Transcript: Human NR_027751.1

Homo sapiens FAM20A golgi associated secretory pathway pseudokinase (FAM20A), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-06-26
Taxon:
Homo sapiens (human)
Gene:
FAM20A (54757)
Length:
3712
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027751.1
NBCI Gene record:
FAM20A (54757)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027751.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428237 GCCTATCACAAGCTGACTAAA pLKO_005 1766 3UTR 100% 13.200 18.480 N FAM20A n/a
2 TRCN0000172656 GCTCCTCAATGTCATCGACAT pLKO.1 891 3UTR 100% 4.050 5.670 N FAM20A n/a
3 TRCN0000168232 CGACTTCTTGATAGGGAATAT pLKO.1 921 3UTR 100% 13.200 10.560 N FAM20A n/a
4 TRCN0000168142 CATTGACTTTCAGAGACACAA pLKO.1 452 3UTR 100% 4.950 3.465 N FAM20A n/a
5 TRCN0000167128 CTTCTTCTACTTCATTGACTT pLKO.1 440 3UTR 100% 4.950 3.465 N FAM20A n/a
6 TRCN0000168563 GAGGATAGTAAATGTCACCAA pLKO.1 539 3UTR 100% 2.640 1.848 N FAM20A n/a
7 TRCN0000441831 CAGCGATGTGATGCGAGAATC pLKO_005 1134 3UTR 100% 10.800 6.480 N FAM20A n/a
8 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 3029 3UTR 100% 4.950 2.475 Y CFLAR n/a
9 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 3029 3UTR 100% 4.950 2.475 Y C19orf31 n/a
10 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 3027 3UTR 100% 4.950 2.475 Y ERN2 n/a
11 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 3027 3UTR 100% 4.950 2.475 Y P3H4 n/a
12 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 3027 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027751.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10241 pDONR223 100% 19.9% None 1_108del;849_3712del n/a
2 ccsbBroad304_10241 pLX_304 0% 19.9% V5 (not translated due to prior stop codon) 1_108del;849_3712del n/a
3 TRCN0000471075 AACATTTGACGGCCCAAGCCAGCC pLX_317 66.7% 19.9% V5 (not translated due to prior stop codon) 1_108del;849_3712del n/a
Download CSV