Transcript: Human NR_028039.1

Homo sapiens CASTOR family member 3 (CASTOR3), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2018-12-04
Taxon:
Homo sapiens (human)
Gene:
CASTOR3 (352954)
Length:
3562
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_028039.1
NBCI Gene record:
CASTOR3 (352954)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_028039.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137335 GCCGTTCTTCATTTGACTCAT pLKO.1 1133 3UTR 100% 4.950 6.930 N CASTOR3 n/a
2 TRCN0000136621 GCAGGATCAATGATGGGATAA pLKO.1 1572 3UTR 100% 10.800 8.640 N CASTOR3 n/a
3 TRCN0000138549 CGTTGTCATCAGAGTTCACCA pLKO.1 695 3UTR 100% 2.640 1.584 N CASTOR3 n/a
4 TRCN0000137168 GTTGTCATCAGAGTTCACCAT pLKO.1 696 3UTR 100% 2.640 1.584 N CASTOR3 n/a
5 TRCN0000352396 CACTGGCTGACCAGAACATAT pLKO_005 599 3UTR 100% 13.200 6.600 Y CASTOR2 n/a
6 TRCN0000337256 ACTGGCTGACCAGAACATATC pLKO_005 600 3UTR 100% 10.800 5.400 Y CASTOR2 n/a
7 TRCN0000337255 CAGAGGATTACACTATCATTG pLKO_005 425 3UTR 100% 10.800 5.400 Y CASTOR2 n/a
8 TRCN0000337254 TGTTCATGCTGTCCACGTATC pLKO_005 623 3UTR 100% 6.000 3.000 Y CASTOR2 n/a
9 TRCN0000138621 CAAGACCAGGTGCAAGTTCTT pLKO.1 387 3UTR 100% 4.950 2.475 Y CASTOR3 n/a
10 TRCN0000137329 GATCAAACTTGCCTTCCTGTT pLKO.1 363 3UTR 100% 4.050 2.025 Y CASTOR3 n/a
11 TRCN0000138745 CAGGTGCAAGTTCTTCAGTCT pLKO.1 393 3UTR 100% 2.640 1.320 Y CASTOR3 n/a
12 TRCN0000136784 CCAGAACATATCCGTGTTCAT pLKO.1 609 3UTR 100% 0.495 0.248 Y CASTOR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_028039.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13623 pDONR223 100% 13.6% None (many diffs) n/a
2 ccsbBroad304_13623 pLX_304 0% 13.6% V5 (many diffs) n/a
3 TRCN0000477107 CCCCAGACCGATGGGTCGTTCCAT pLX_317 67.1% 13.6% V5 (many diffs) n/a
Download CSV