Transcript: Mouse NR_028260.1

Mus musculus AFG3-like AAA ATPase 1 (Afg3l1), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Afg3l1 (114896)
Length:
4172
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_028260.1
NBCI Gene record:
Afg3l1 (114896)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_028260.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031212 TCCACTAATGTGGTAGTGTTA pLKO.1 1354 3UTR 100% 0.495 0.693 N Afg3l1 n/a
2 TRCN0000031213 GAAACACTTCGTGCAGTATTA pLKO.1 549 3UTR 100% 13.200 10.560 N Afg3l1 n/a
3 TRCN0000326059 GAAACACTTCGTGCAGTATTA pLKO_005 549 3UTR 100% 13.200 10.560 N Afg3l1 n/a
4 TRCN0000031209 GCTTCACTGGTGCTGATATTT pLKO.1 1568 3UTR 100% 15.000 10.500 N Afg3l1 n/a
5 TRCN0000325986 GCTTCACTGGTGCTGATATTT pLKO_005 1568 3UTR 100% 15.000 10.500 N Afg3l1 n/a
6 TRCN0000031210 CCTGGTTAGCATCCTCCTATA pLKO.1 813 3UTR 100% 10.800 7.560 N Afg3l1 n/a
7 TRCN0000325984 CCTGGTTAGCATCCTCCTATA pLKO_005 813 3UTR 100% 10.800 7.560 N Afg3l1 n/a
8 TRCN0000031211 GCAGCTGTTCTTTGGTCAGAT pLKO.1 1813 3UTR 100% 4.950 3.465 N Afg3l1 n/a
9 TRCN0000354080 GCAGCTGTTCTTTGGTCAGAT pLKO_005 1813 3UTR 100% 4.950 3.465 N Afg3l1 n/a
10 TRCN0000114051 GCCTGGTTTACAGAGTGAGTT pLKO.1 2846 3UTR 100% 4.950 2.475 Y H2-T3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_028260.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10220 pDONR223 100% 7.5% None (many diffs) n/a
2 ccsbBroad304_10220 pLX_304 0% 7.5% V5 (many diffs) n/a
Download CSV