Transcript: Human NR_028402.2

Homo sapiens lysine acetyltransferase 14 (KAT14), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2018-12-04
Taxon:
Homo sapiens (human)
Gene:
KAT14 (57325)
Length:
3152
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_028402.2
NBCI Gene record:
KAT14 (57325)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_028402.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107702 CCCTTATACCTCTCGGATCTT pLKO.1 1648 3UTR 100% 4.950 6.930 N KAT14 n/a
2 TRCN0000107700 CGGCCATTGATGTGTTGTCAT pLKO.1 2685 3UTR 100% 4.950 6.930 N KAT14 n/a
3 TRCN0000416788 ACCTTATATCAGGCGTGATTA pLKO_005 1672 3UTR 100% 13.200 9.240 N KAT14 n/a
4 TRCN0000416728 AGTTACCTTAAGGGTGATAAT pLKO_005 155 3UTR 100% 13.200 9.240 N KAT14 n/a
5 TRCN0000107704 GCACCTCTCGATTACTGTTAT pLKO.1 1781 3UTR 100% 13.200 9.240 N KAT14 n/a
6 TRCN0000430998 TTATGAATGATGTCGTGATTC pLKO_005 2467 3UTR 100% 10.800 7.560 N KAT14 n/a
7 TRCN0000107703 CAAGGTTATTTCAGGTGGAAA pLKO.1 302 3UTR 100% 4.950 3.465 N KAT14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_028402.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03811 pDONR223 100% 66.2% None (many diffs) n/a
2 ccsbBroad304_03811 pLX_304 0% 66.2% V5 (many diffs) n/a
3 ccsbBroadEn_15945 pDONR223 0% 62.2% None 1_259del;2222_3152del n/a
4 ccsbBroad304_15945 pLX_304 0% 62.2% V5 1_259del;2222_3152del n/a
5 TRCN0000478980 CCCTTCCTAACATGTATGTAACCC pLX_317 22.9% 62.2% V5 1_259del;2222_3152del n/a
Download CSV