Transcript: Human NR_030755.1

Homo sapiens microRNA 650 (MIR650), microRNA.

Source:
NCBI, updated 2019-02-03
Taxon:
Homo sapiens (human)
Gene:
MIR650 (723778)
Length:
96
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_030755.1
NBCI Gene record:
MIR650 (723778)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_030755.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_030755.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10916 pDONR223 100% 6.5% None (many diffs) n/a
2 ccsbBroad304_10916 pLX_304 0% 6.5% V5 (many diffs) n/a
3 ccsbBroadEn_10915 pDONR223 100% 6.3% None (many diffs) n/a
4 ccsbBroad304_10915 pLX_304 0% 6.3% V5 (many diffs) n/a
5 TRCN0000475429 ACCGGCATCGATTTAACCTCCATT pLX_317 30.7% 6.3% V5 (many diffs) n/a
6 ccsbBroadEn_11885 pDONR223 100% 6.3% None (many diffs) n/a
7 ccsbBroad304_11885 pLX_304 0% 6.3% V5 (many diffs) n/a
8 TRCN0000481522 TTGACAGGACTAGAGCATCGAGGT pLX_317 57.7% 6.3% V5 (many diffs) n/a
Download CSV