Transcript: Human NR_033169.2

Homo sapiens polypeptide N-acetylgalactosaminyltransferase like 5 (GALNTL5), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
GALNTL5 (168391)
Length:
1912
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033169.2
NBCI Gene record:
GALNTL5 (168391)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_033169.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000444931 TGCTATACGTCGGCATTATTT pLKO_005 1388 3UTR 100% 15.000 21.000 N GALNTL5 n/a
2 TRCN0000447573 GATAGAACTCTGGAGTATAAG pLKO_005 1233 3UTR 100% 13.200 18.480 N GALNTL5 n/a
3 TRCN0000035558 CGAGCGTGTTGAGTTAAGGAA pLKO.1 1685 3UTR 100% 3.000 4.200 N GALNTL5 n/a
4 TRCN0000439145 CGAGTAGGACATATCAGTAAG pLKO_005 1521 3UTR 100% 10.800 8.640 N GALNTL5 n/a
5 TRCN0000035555 GCATTGTCATTTGCTTCTATA pLKO.1 862 3UTR 100% 13.200 9.240 N GALNTL5 n/a
6 TRCN0000450738 TTTGATTGGAACCTACAATTT pLKO_005 1278 3UTR 100% 13.200 9.240 N GALNTL5 n/a
7 TRCN0000035556 CAGTGCTATGACACATAACTA pLKO.1 1571 3UTR 100% 5.625 3.938 N GALNTL5 n/a
8 TRCN0000035557 CCAGAACTTCATAAAGAACTT pLKO.1 578 3UTR 100% 4.950 3.465 N GALNTL5 n/a
9 TRCN0000035554 CCTGCAATGTCTGGAGGAATT pLKO.1 1365 3UTR 100% 0.000 0.000 N GALNTL5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033169.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09775 pDONR223 100% 69.4% None (many diffs) n/a
2 ccsbBroad304_09775 pLX_304 0% 69.4% V5 (many diffs) n/a
Download CSV