Transcript: Mouse NR_033241.1

Mus musculus bone morphogenetic protein 1 (Bmp1), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Bmp1 (12153)
Length:
4464
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033241.1
NBCI Gene record:
Bmp1 (12153)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_033241.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031378 CGACAACAAACATGACTGTAA pLKO.1 3141 3UTR 100% 4.950 6.930 N Bmp1 n/a
2 TRCN0000308998 CGACAACAAACATGACTGTAA pLKO_005 3141 3UTR 100% 4.950 6.930 N Bmp1 n/a
3 TRCN0000003499 GCGCTACTGTGGCTATGAGAA pLKO.1 1796 3UTR 100% 4.950 6.930 N BMP1 n/a
4 TRCN0000031376 GTACCGTATCTCCCTGCAATT pLKO.1 2153 3UTR 100% 0.000 0.000 N Bmp1 n/a
5 TRCN0000309001 GTACCGTATCTCCCTGCAATT pLKO_005 2153 3UTR 100% 0.000 0.000 N Bmp1 n/a
6 TRCN0000031377 GACACCATTGTTCCCAAGTAT pLKO.1 1125 3UTR 100% 5.625 4.500 N Bmp1 n/a
7 TRCN0000308933 GACACCATTGTTCCCAAGTAT pLKO_005 1125 3UTR 100% 5.625 4.500 N Bmp1 n/a
8 TRCN0000031374 GCCGTCTTTACACACTGTATT pLKO.1 4195 3UTR 100% 13.200 9.240 N Bmp1 n/a
9 TRCN0000309000 GCCGTCTTTACACACTGTATT pLKO_005 4195 3UTR 100% 13.200 9.240 N Bmp1 n/a
10 TRCN0000031375 CCGTTTGTGATTGGAGGGAAT pLKO.1 644 3UTR 100% 4.050 2.835 N Bmp1 n/a
11 TRCN0000308935 CCGTTTGTGATTGGAGGGAAT pLKO_005 644 3UTR 100% 4.050 2.835 N Bmp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033241.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05897 pDONR223 100% 59.1% None (many diffs) n/a
2 ccsbBroad304_05897 pLX_304 0% 59.1% V5 (many diffs) n/a
3 TRCN0000477087 GCGCGCCTTTGGAGAACAACTCGG pLX_317 13.6% 59.1% V5 (many diffs) n/a
Download CSV