Transcript: Human NR_033267.1

Homo sapiens FGFR1 oncogene partner 2 pseudogene (LOC100335030), non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
LOC100335030 (100335030)
Length:
3162
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033267.1
NBCI Gene record:
LOC100335030 (100335030)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_033267.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336753 GCCACGGTCCACGTTAGTTAT pLKO_005 523 3UTR 100% 13.200 6.600 Y FGFR1OP2 n/a
2 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2078 3UTR 100% 4.950 2.475 Y ERAP2 n/a
3 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2079 3UTR 100% 13.200 6.600 Y LIAS n/a
4 TRCN0000107105 CGAGGTCAGGAGTTTGAGATT pLKO.1 2122 3UTR 100% 4.950 2.475 Y NLRP12 n/a
5 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 2243 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033267.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02918 pDONR223 100% 14.2% None (many diffs) n/a
2 ccsbBroad304_02918 pLX_304 0% 14.2% V5 (many diffs) n/a
3 TRCN0000480334 CCAATTAGCTTCCAACTTATCCCT pLX_317 73.6% 14.2% V5 (many diffs) n/a
Download CSV