Transcript: Human NR_033436.2

Homo sapiens PHD finger protein 14 (PHF14), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
PHF14 (9678)
Length:
2639
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033436.2
NBCI Gene record:
PHF14 (9678)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_033436.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277685 AGTTGAATATACCGGCAATTT pLKO_005 1742 3UTR 100% 13.200 18.480 N PHF14 n/a
2 TRCN0000379935 GTGCTTCAGCTATTCGTAAAC pLKO_005 1379 3UTR 100% 10.800 15.120 N PHF14 n/a
3 TRCN0000277624 GGGATGTGCAGAGCCTATTTC pLKO_005 1045 3UTR 100% 13.200 10.560 N PHF14 n/a
4 TRCN0000380683 ACCAGTAACACTAACGGAAAT pLKO_005 936 3UTR 100% 10.800 8.640 N PHF14 n/a
5 TRCN0000222118 CCAAGAAGATTCCGATAAGAA pLKO.1 2120 3UTR 100% 5.625 4.500 N PHF14 n/a
6 TRCN0000019309 CGCATGATTCAAATTCAGGAA pLKO.1 1549 3UTR 100% 2.640 2.112 N PHF14 n/a
7 TRCN0000312505 CGCATGATTCAAATTCAGGAA pLKO_005 1549 3UTR 100% 2.640 2.112 N PHF14 n/a
8 TRCN0000277684 CGATCAAGGAGGCAGATTAAG pLKO_005 2059 3UTR 100% 13.200 9.240 N PHF14 n/a
9 TRCN0000222117 GCAGATCCATTCTTTGCTTAT pLKO.1 1126 3UTR 100% 10.800 7.560 N PHF14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033436.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07464 pDONR223 100% 67.1% None (many diffs) n/a
2 ccsbBroad304_07464 pLX_304 0% 67.1% V5 (many diffs) n/a
3 TRCN0000476554 CCACGAACTAGCCATATCATCTGC pLX_317 15.5% 67.1% V5 (many diffs) n/a
Download CSV