Transcript: Mouse NR_033512.1

Mus musculus predicted gene 6194 (Gm6194), non-coding RNA.

Source:
NCBI, updated 2013-07-17
Taxon:
Mus musculus (mouse)
Gene:
Gm6194 (620966)
Length:
1712
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033512.1
NBCI Gene record:
Gm6194 (620966)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_033512.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087486 CCTGTGGATCTGCCCATTGTT pLKO.1 368 3UTR 100% 5.625 3.938 N Gm6194 n/a
2 TRCN0000087483 CACGACTTCATCGAGACCAAT pLKO.1 449 3UTR 100% 4.950 2.970 N Gm6194 n/a
3 TRCN0000039462 CCACAAGTGGTCACACACATA pLKO.1 616 3UTR 100% 4.950 2.475 Y Tmem189 n/a
4 TRCN0000324026 CCACAAGTGGTCACACACATA pLKO_005 616 3UTR 100% 4.950 2.475 Y Tmem189 n/a
5 TRCN0000087484 CGTCTTCTGTCTGACCATCTT pLKO.1 574 3UTR 100% 4.950 2.475 Y Gm6194 n/a
6 TRCN0000087485 GCTAAACATGGCCTACAAGTT pLKO.1 502 3UTR 100% 4.950 2.475 Y Gm6194 n/a
7 TRCN0000087487 CCCTTGGGAATGCTTCGTCTT pLKO.1 559 3UTR 100% 4.050 2.025 Y Gm6194 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033512.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10085 pDONR223 100% 40.5% None (many diffs) n/a
2 ccsbBroad304_10085 pLX_304 0% 40.5% V5 (many diffs) n/a
3 TRCN0000476515 CCCCGTCATCGCAAGACTCACATA pLX_317 40.3% 40.5% V5 (many diffs) n/a
Download CSV