Transcript: Human NR_036443.1

Homo sapiens hect domain and RLD 2 pseudogene 9 (HERC2P9), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
HERC2P9 (440248)
Length:
2962
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_036443.1
NBCI Gene record:
HERC2P9 (440248)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_036443.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118443 CGTTACTCAGAGGCCCAGTTA pLKO.1 151 3UTR 100% 4.950 6.930 N HERC2P9 n/a
2 TRCN0000118372 CCTGCTTCTTTAACTTGATAA pLKO.1 2712 3UTR 100% 13.200 6.600 Y HERC2P2 n/a
3 TRCN0000153335 GCAGATCTTAGCTGTGCATTT pLKO.1 11 3UTR 100% 10.800 5.400 Y HERC2P3 n/a
4 TRCN0000153856 CCAGCAGTTGAAGCTATACAT pLKO.1 561 3UTR 100% 5.625 2.813 Y HERC2P3 n/a
5 TRCN0000152439 CGTGGCCTTTAATGTGAACAA pLKO.1 402 3UTR 100% 4.950 2.475 Y HERC2P3 n/a
6 TRCN0000118374 GCTGTATATGTGAGAGAGAAT pLKO.1 1297 3UTR 100% 4.950 2.475 Y HERC2P2 n/a
7 TRCN0000118442 CCAGGCATACATTTGGCAGAA pLKO.1 1731 3UTR 100% 4.050 2.025 Y HERC2P9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_036443.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10386 pDONR223 100% 43.1% None 1_216del;1495_2962del n/a
2 ccsbBroad304_10386 pLX_304 0% 43.1% V5 1_216del;1495_2962del n/a
3 TRCN0000475511 ATATGGTCGGTGCGGGTATATATA pLX_317 35.5% 43.1% V5 1_216del;1495_2962del n/a
Download CSV