Transcript: Human NR_036454.2

Homo sapiens charged multivesicular body protein 3 (CHMP3), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
CHMP3 (51652)
Length:
2897
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_036454.2
NBCI Gene record:
CHMP3 (51652)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_036454.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381536 TAGATTGCCCTGTGCAGTAAA pLKO_005 892 3UTR 100% 13.200 6.600 Y CHMP3 n/a
2 TRCN0000379649 TCGCAAAGGGATTGTTCTTAT pLKO_005 669 3UTR 100% 13.200 6.600 Y CHMP3 n/a
3 TRCN0000381532 TGATGAAGGCTGGGATCATAG pLKO_005 255 3UTR 100% 10.800 5.400 Y CHMP3 n/a
4 TRCN0000180845 GCACCCAGTAAAGTGACTGAT pLKO.1 392 3UTR 100% 4.950 2.475 Y CHMP3 n/a
5 TRCN0000150106 CAAAGTCTTGTGAAGATTCCA pLKO.1 197 3UTR 100% 3.000 1.500 Y CHMP3 n/a
6 TRCN0000297794 CAAAGTCTTGTGAAGATTCCA pLKO_005 197 3UTR 100% 3.000 1.500 Y CHMP3 n/a
7 TRCN0000149440 GATCAGGAAGAAATGGAGGAA pLKO.1 311 3UTR 100% 2.640 1.320 Y CHMP3 n/a
8 TRCN0000297792 GATCAGGAAGAAATGGAGGAA pLKO_005 311 3UTR 100% 2.640 1.320 Y CHMP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_036454.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03356 pDONR223 100% 14.6% None (many diffs) n/a
2 ccsbBroad304_03356 pLX_304 0% 14.6% V5 (many diffs) n/a
3 TRCN0000466056 GATTGTGGGACCCCCCCAGGACAG pLX_317 56.5% 14.6% V5 (many diffs) n/a
Download CSV