Transcript: Human NR_036475.2

Homo sapiens Dexi homolog (mouse) pseudogene (LOC100289656), non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
LOC100289656 (100289656)
Length:
895
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_036475.2
NBCI Gene record:
LOC100289656 (100289656)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_036475.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273626 CTGCTGCCCTCTATGTTCTAC pLKO_005 771 3UTR 100% 4.950 2.475 Y DEXI n/a
2 TRCN0000273627 CATGGAGTACATCGTCCTCAA pLKO_005 839 3UTR 100% 4.050 2.025 Y DEXI n/a
3 TRCN0000149370 GTTCTTCGTCAATGTGCTGAT pLKO.1 800 3UTR 100% 4.050 2.025 Y DEXI n/a
4 TRCN0000273625 GTTCTTCGTCAATGTGCTGAT pLKO_005 800 3UTR 100% 4.050 2.025 Y DEXI n/a
5 TRCN0000129347 CCTGTTCTTCGTCAATGTGCT pLKO.1 797 3UTR 100% 2.640 1.320 Y DEXI n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_036475.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03043 pDONR223 100% 19.4% None 1_701del;879_880delTTinsCC;895_896ins91 n/a
2 ccsbBroad304_03043 pLX_304 0% 19.4% V5 1_701del;879_880delTTinsCC;895_896ins91 n/a
3 TRCN0000468584 CGATCCGATAACGGACCGGCAGTC pLX_317 100% 19.4% V5 1_701del;879_880delTTinsCC;895_896ins91 n/a
Download CSV