Transcript: Human NR_037568.2

Homo sapiens mitochondrial ribosomal protein L49 (MRPL49), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
MRPL49 (740)
Length:
1875
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_037568.2
NBCI Gene record:
MRPL49 (740)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_037568.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276509 CACCCAACCTGCCTTACTTTG pLKO_005 111 3UTR 100% 10.800 7.560 N MRPL49 n/a
2 TRCN0000178727 CCTGGAGATTCCATTCCATTT pLKO.1 1694 3UTR 100% 10.800 7.560 N MRPL49 n/a
3 TRCN0000276564 CCTGGAGATTCCATTCCATTT pLKO_005 1694 3UTR 100% 10.800 7.560 N MRPL49 n/a
4 TRCN0000155725 CTGCAGAAAGACGTGGAAGAT pLKO.1 233 3UTR 100% 4.950 3.465 N MRPL49 n/a
5 TRCN0000276565 CTGCAGAAAGACGTGGAAGAT pLKO_005 233 3UTR 100% 4.950 3.465 N MRPL49 n/a
6 TRCN0000156198 CCTCTTGAGTAGCTGGGATTA pLKO.1 758 3UTR 100% 10.800 5.400 Y MRPL49 n/a
7 TRCN0000276507 CCTCTTGAGTAGCTGGGATTA pLKO_005 758 3UTR 100% 10.800 5.400 Y MRPL49 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_037568.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00191 pDONR223 100% 17.1% None 1_26del;103_104ins151;374_1875del n/a
2 ccsbBroad304_00191 pLX_304 0% 17.1% V5 1_26del;103_104ins151;374_1875del n/a
3 TRCN0000466908 AGTGGCGTCGTCTGATCTGAAAAA pLX_317 87.2% 17.1% V5 1_26del;103_104ins151;374_1875del n/a
4 ccsbBroadEn_12783 pDONR223 100% 10% None (many diffs) n/a
5 ccsbBroad304_12783 pLX_304 0% 10% V5 (many diffs) n/a
6 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 10% V5 (many diffs) n/a
Download CSV