Transcript: Human NR_037606.1

Homo sapiens mitochondrial ribosomal protein S14 (MRPS14), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-06-26
Taxon:
Homo sapiens (human)
Gene:
MRPS14 (63931)
Length:
2252
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_037606.1
NBCI Gene record:
MRPS14 (63931)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_037606.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117663 CGTATAGTCTTCCGTCACTTA pLKO.1 461 3UTR 100% 4.950 6.930 N MRPS14 n/a
2 TRCN0000333156 CGTATAGTCTTCCGTCACTTA pLKO_005 461 3UTR 100% 4.950 6.930 N MRPS14 n/a
3 TRCN0000117666 GCGCGATGTGAAGAGACGAAA pLKO.1 244 3UTR 100% 4.950 6.930 N MRPS14 n/a
4 TRCN0000344706 AGTACAAAGAGTAGCATAATA pLKO_005 753 3UTR 100% 15.000 10.500 N MRPS14 n/a
5 TRCN0000353024 GATGAGAGGCTACGTATTAAT pLKO_005 284 3UTR 100% 15.000 10.500 N MRPS14 n/a
6 TRCN0000344647 CCAGCGAGCGACATGGTAAAT pLKO_005 508 3UTR 100% 13.200 9.240 N MRPS14 n/a
7 TRCN0000117664 AGAATCAGAAATCGGTGTGTT pLKO.1 395 3UTR 100% 4.950 3.465 N MRPS14 n/a
8 TRCN0000117662 GCAGTTTGTAATCCTGGACTA pLKO.1 916 3UTR 100% 4.050 2.835 N MRPS14 n/a
9 TRCN0000344648 CACTCAGGAAGAATACCATTT pLKO_005 306 3UTR 100% 10.800 6.480 N MRPS14 n/a
10 TRCN0000104437 GCTGTCCTGTTAGAATCAGAA pLKO.1 384 3UTR 100% 4.950 2.970 N Mrps14 n/a
11 TRCN0000302532 GCTGTCCTGTTAGAATCAGAA pLKO_005 384 3UTR 100% 4.950 2.970 N Mrps14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_037606.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03909 pDONR223 100% 17% None 1_47del;92_183del;524_2252del n/a
2 ccsbBroad304_03909 pLX_304 0% 17% V5 1_47del;92_183del;524_2252del n/a
3 TRCN0000470637 TGGGAGCCGTAGTCCGCCAAAGGC pLX_317 100% 17% V5 1_47del;92_183del;524_2252del n/a
Download CSV