Transcript: Human NR_037635.1

Homo sapiens GJA9-MYCBP readthrough (GJA9-MYCBP), transcript variant 3, long non-coding RNA.

Source:
NCBI, updated 2018-09-16
Taxon:
Homo sapiens (human)
Gene:
GJA9-MYCBP (100527950)
Length:
2672
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_037635.1
NBCI Gene record:
GJA9-MYCBP (100527950)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_037635.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416981 ATGATGGCACTGGTTGTATTT pLKO_005 774 3UTR 100% 13.200 6.600 Y MYCBP n/a
2 TRCN0000021650 CCAAGGTGTTGGTAGCCTTAT pLKO.1 263 3UTR 100% 10.800 5.400 Y MYCBP n/a
3 TRCN0000305594 AGCGTGCTGAATAGGATTCTT pLKO_005 479 3UTR 100% 5.625 2.813 Y Mycbp n/a
4 TRCN0000418296 AGCGTGCTGAATAGGATTCTT pLKO_005 479 3UTR 100% 5.625 2.813 Y MYCBP n/a
5 TRCN0000021653 GAGAAGTATGAAGCTATTGTA pLKO.1 400 3UTR 100% 5.625 2.813 Y MYCBP n/a
6 TRCN0000021651 GCAAAGCTTGCTCAGTATGAA pLKO.1 442 3UTR 100% 5.625 2.813 Y MYCBP n/a
7 TRCN0000021649 GCCGAAATGAAAGAGAAGTAT pLKO.1 388 3UTR 100% 5.625 2.813 Y MYCBP n/a
8 TRCN0000095862 CTTATATGAAGAACCAGAGAA pLKO.1 279 3UTR 100% 4.950 2.475 Y Mycbp n/a
9 TRCN0000438373 TGAGCAGTTCCGGAGGTACTT pLKO_005 213 3UTR 100% 4.950 2.475 Y MYCBP n/a
10 TRCN0000021652 CAGAGAAACCTAACAGTGCTT pLKO.1 293 3UTR 100% 2.640 1.320 Y MYCBP n/a
11 TRCN0000095863 CCTTATATGAAGAACCAGAGA pLKO.1 278 3UTR 100% 2.640 1.320 Y Mycbp n/a
12 TRCN0000323585 CCTTATATGAAGAACCAGAGA pLKO_005 278 3UTR 100% 2.640 1.320 Y Mycbp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_037635.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02955 pDONR223 100% 11.4% None (many diffs) n/a
2 ccsbBroad304_02955 pLX_304 0% 11.4% V5 (many diffs) n/a
3 TRCN0000480712 ATCTAAAATCCATCACGACCTCTT pLX_317 100% 11.4% V5 (many diffs) n/a
Download CSV