Transcript: Human NR_037771.2

Homo sapiens SEC23 interacting protein (SEC23IP), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
SEC23IP (11196)
Length:
6615
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_037771.2
NBCI Gene record:
SEC23IP (11196)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_037771.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426033 GGACACAGATAGTCGATTTAT pLKO_005 567 3UTR 100% 15.000 21.000 N SEC23IP n/a
2 TRCN0000064954 CGCTACGATGTTTACCTCTAT pLKO.1 472 3UTR 100% 4.950 6.930 N SEC23IP n/a
3 TRCN0000064955 CGCTTGATCCAGTGGCATATA pLKO.1 1988 3UTR 100% 13.200 10.560 N SEC23IP n/a
4 TRCN0000434558 GTATTGTTAGTGGGCTATTAA pLKO_005 2888 3UTR 100% 15.000 10.500 N SEC23IP n/a
5 TRCN0000432555 TCGCTCTTCAGAGTCACTTAT pLKO_005 2414 3UTR 100% 13.200 9.240 N SEC23IP n/a
6 TRCN0000433211 GATGCCTCAAGTTGACCATTT pLKO_005 837 3UTR 100% 10.800 7.560 N SEC23IP n/a
7 TRCN0000416380 TTGCCAAGTATTGGTCGATTT pLKO_005 1084 3UTR 100% 10.800 7.560 N SEC23IP n/a
8 TRCN0000064953 CCAATGAAACTTTGCTAGATA pLKO.1 1115 3UTR 100% 5.625 3.938 N SEC23IP n/a
9 TRCN0000064957 GCTCTGTTACTACTTAAAGAA pLKO.1 2458 3UTR 100% 5.625 3.938 N SEC23IP n/a
10 TRCN0000064956 CCTGTGTGTGACTTACGCTTT pLKO.1 883 3UTR 100% 4.050 2.835 N SEC23IP n/a
11 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 5451 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_037771.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14065 pDONR223 100% 34.4% None (many diffs) n/a
2 ccsbBroad304_14065 pLX_304 0% 34.4% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000472422 AGGCCGGAGTGTTCCCAGATCCTT pLX_317 12.9% 34.4% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV