Transcript: Human NR_037923.1

Homo sapiens DNAAF4-CCPG1 readthrough (NMD candidate) (DNAAF4-CCPG1), long non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
DNAAF4-CCPG1 (100533483)
Length:
4838
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_037923.1
NBCI Gene record:
DNAAF4-CCPG1 (100533483)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_037923.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183068 CCACCTAAGTTAGAAGAAATT pLKO.1 1748 3UTR 100% 13.200 6.600 Y CCPG1 n/a
2 TRCN0000143888 CCAGAATGGTTGAAGGATAAA pLKO.1 1123 3UTR 100% 13.200 6.600 Y DNAAF4 n/a
3 TRCN0000243129 GACAAGTACTGAATTAGTTAA pLKO_005 2443 3UTR 100% 13.200 6.600 Y CCPG1 n/a
4 TRCN0000243125 TAGATAATGATGGAGTATTTG pLKO_005 3564 3UTR 100% 13.200 6.600 Y CCPG1 n/a
5 TRCN0000243127 TGAATGATATGAAGGATTATC pLKO_005 2181 3UTR 100% 13.200 6.600 Y CCPG1 n/a
6 TRCN0000142794 CCTGTTACAGACAATGCTAAT pLKO.1 1324 3UTR 100% 10.800 5.400 Y DNAAF4 n/a
7 TRCN0000140714 GACGGGTGTTGACAAAGAGAT pLKO.1 519 3UTR 100% 4.950 2.475 Y DNAAF4 n/a
8 TRCN0000143792 GCCTGGAAAGAATATCAAAGA pLKO.1 736 3UTR 100% 4.950 2.475 Y DNAAF4 n/a
9 TRCN0000141494 CGTGAATCACAAGTAGCAGAA pLKO.1 1009 3UTR 100% 4.050 2.025 Y DNAAF4 n/a
10 TRCN0000143387 GCATTTCTTTATGCTCCCATA pLKO.1 406 3UTR 100% 4.050 2.025 Y DNAAF4 n/a
11 TRCN0000141967 GCATCTAGAAATCTTGCTCCA pLKO.1 868 3UTR 100% 2.160 1.080 Y DNAAF4 n/a
12 TRCN0000143853 CAGCATTCTGTCAACTAGAAT pLKO.1 1376 3UTR 100% 0.563 0.281 Y DNAAF4 n/a
13 TRCN0000243128 TACCCGAAGACAGTATCTATA pLKO_005 1686 3UTR 100% 0.000 0.000 Y CCPG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_037923.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11352 pDONR223 100% 37.4% None (many diffs) n/a
2 ccsbBroad304_11352 pLX_304 0% 37.4% V5 (many diffs) n/a
3 TRCN0000479237 GCGTTTACATTCCGTCAGGGGGGG pLX_317 23.5% 37.4% V5 (many diffs) n/a
4 ccsbBroadEn_09736 pDONR223 100% 22.8% None (many diffs) n/a
5 ccsbBroad304_09736 pLX_304 0% 22.8% V5 (many diffs) n/a
6 TRCN0000468127 GGCATTTACGATATTGCCTGAGTT pLX_317 33.9% 22.8% V5 (many diffs) n/a
Download CSV