Transcript: Human NR_038459.1

Homo sapiens glucose-fructose oxidoreductase domain containing 1 (GFOD1), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-13
Taxon:
Homo sapiens (human)
Gene:
GFOD1 (54438)
Length:
1458
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_038459.1
NBCI Gene record:
GFOD1 (54438)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_038459.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148733 CCAGTATAATGTGCTGCAGTA pLKO.1 1170 3UTR 100% 4.050 3.240 N GFOD1 n/a
2 TRCN0000147417 GATTACAGATAGATGCGTTCA pLKO.1 507 3UTR 100% 4.050 3.240 N GFOD1 n/a
3 TRCN0000146281 CCAGTCAAGATTACAGATAGA pLKO.1 499 3UTR 100% 4.950 3.465 N GFOD1 n/a
4 TRCN0000149208 GACCCAGTCAAGATTACAGAT pLKO.1 496 3UTR 100% 4.950 3.465 N GFOD1 n/a
5 TRCN0000129145 GAACTCATCATCTATCCAGAA pLKO.1 741 3UTR 100% 4.050 2.835 N GFOD1 n/a
6 TRCN0000150210 CAACTGCAGTATTTATCGGTT pLKO.1 591 3UTR 100% 2.640 1.848 N GFOD1 n/a
7 TRCN0000149148 GTGGACATTTAGCATCTCCAT pLKO.1 886 3UTR 100% 2.640 1.848 N GFOD1 n/a
8 TRCN0000129009 GTGTCATTGATTCTGTGACAT pLKO.1 949 3UTR 100% 0.495 0.347 N GFOD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_038459.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09262 pDONR223 100% 27.9% None 1_433del;833T>A;842_1458del n/a
2 ccsbBroad304_09262 pLX_304 0% 27.9% V5 1_433del;833T>A;842_1458del n/a
3 TRCN0000480401 TCATAAAAGATACCATCTCGTCTA pLX_317 98.6% 27.9% V5 1_433del;833T>A;842_1458del n/a
Download CSV