Transcript: Human NR_038967.1

Homo sapiens LOC100289561-PRKRIP1 readthrough (LOC100630923), long non-coding RNA.

Source:
NCBI, updated 2018-12-04
Taxon:
Homo sapiens (human)
Gene:
LOC100630923 (100630923)
Length:
2911
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_038967.1
NBCI Gene record:
LOC100630923 (100630923)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_038967.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263278 CCCGAGTTCCTGAGTCTATTT pLKO_005 2632 3UTR 100% 13.200 6.600 Y PRKRIP1 n/a
2 TRCN0000143382 GAAGAAGCGCCAGAAGTTAAA pLKO.1 1169 3UTR 100% 13.200 6.600 Y PRKRIP1 n/a
3 TRCN0000365091 GGAAGAAGCGCCAGAAGTTAA pLKO_005 1168 3UTR 100% 13.200 6.600 Y PRKRIP1 n/a
4 TRCN0000263279 TACTGGCAAAGAAGATGAAAC pLKO_005 1201 3UTR 100% 10.800 5.400 Y PRKRIP1 n/a
5 TRCN0000218389 ATGATTATCACCAAGCCAAAC pLKO_005 804 3UTR 100% 6.000 3.000 Y PMS2P3 n/a
6 TRCN0000144665 GAAAGGAAACCCAGAAACATT pLKO.1 2707 3UTR 100% 5.625 2.813 Y PRKRIP1 n/a
7 TRCN0000377446 ATTGGATGCAGAGTTTCAGAA pLKO_005 1097 3UTR 100% 4.950 2.475 Y PRKRIP1 n/a
8 TRCN0000377447 CATGGATGCCATGGCTGAGAA pLKO_005 1070 3UTR 100% 4.950 2.475 Y PRKRIP1 n/a
9 TRCN0000122551 CCCAGAATTTGTCCGAGATGT pLKO.1 965 3UTR 100% 4.950 2.475 Y PRKRIP1 n/a
10 TRCN0000107283 CCCTGATGAGAAGATAGCATA pLKO.1 736 3UTR 100% 4.950 2.475 Y PMS2P3 n/a
11 TRCN0000141946 GAGTTCCACGTGTACAGACAT pLKO.1 1017 3UTR 100% 4.950 2.475 Y PRKRIP1 n/a
12 TRCN0000144666 GCCACATATTTGAACAGTGAT pLKO.1 1598 3UTR 100% 4.950 2.475 Y PRKRIP1 n/a
13 TRCN0000263277 TATCAGCGACAGGACTACATG pLKO_005 1053 3UTR 100% 4.950 2.475 Y PRKRIP1 n/a
14 TRCN0000230061 CCAAGCCAAACATCATCATGG pLKO_005 814 3UTR 100% 4.050 2.025 Y PMS2P3 n/a
15 TRCN0000141202 CCAGAATTTGTCCGAGATGTC pLKO.1 966 3UTR 100% 4.050 2.025 Y PRKRIP1 n/a
16 TRCN0000107282 CCGTGGATAATGGAAGGTGAA pLKO.1 869 3UTR 100% 4.050 2.025 Y PMS2P3 n/a
17 TRCN0000230062 TCATCATGGAGTGGAGGTGAA pLKO_005 826 3UTR 100% 4.050 2.025 Y PMS2P3 n/a
18 TRCN0000144963 GAACAGAAGAAACAAGAAGGA pLKO.1 1224 3UTR 100% 2.640 1.320 Y PRKRIP1 n/a
19 TRCN0000107281 GTATGATTATCACCAAGCCAA pLKO.1 802 3UTR 100% 2.640 1.320 Y PMS2P3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_038967.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14268 pDONR223 100% 16.7% None (many diffs) n/a
2 ccsbBroad304_14268 pLX_304 0% 16.7% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000474129 GACCGGATGACCACTGCCTTGGTG pLX_317 78.8% 16.7% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV