Transcript: Human NR_045000.1

Homo sapiens ACTR3B pseudogene 5 (ACTR3BP5), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
ACTR3BP5 (399746)
Length:
1646
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_045000.1
NBCI Gene record:
ACTR3BP5 (399746)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_045000.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154942 GCCTCAACTCTGGAGTTATTT pLKO.1 1102 3UTR 100% 15.000 7.500 Y ACTR3BP2 n/a
2 TRCN0000156508 GAGGTACTAGCCTTGGAAGTA pLKO.1 392 3UTR 100% 4.950 2.475 Y ACTR3BP2 n/a
3 TRCN0000154898 GCCTTATGGTTTGGAAGCTTA pLKO.1 1075 3UTR 100% 4.950 2.475 Y ACTR3BP2 n/a
4 TRCN0000156192 CCTTGGAAGTATCTTGGACAT pLKO.1 402 3UTR 100% 4.050 2.025 Y ACTR3BP2 n/a
5 TRCN0000414906 GAGTCAGCAAAGGTAGTTGAC pLKO_005 74 3UTR 100% 4.050 2.025 Y ACTR3B n/a
6 TRCN0000157574 GCAGCACTATGCCTTATGGTT pLKO.1 1065 3UTR 100% 3.000 1.500 Y ACTR3BP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_045000.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03802 pDONR223 100% 51.1% None (many diffs) n/a
2 ccsbBroad304_03802 pLX_304 0% 51.1% V5 (many diffs) n/a
3 TRCN0000491360 AAGTAAGAACTACCAGACTCACCT pLX_317 33.1% 51.1% V5 (many diffs) n/a
Download CSV