Transcript: Mouse NR_045518.1

Mus musculus claudin domain containing 1 (Cldnd1), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2016-09-01
Taxon:
Mus musculus (mouse)
Gene:
Cldnd1 (224250)
Length:
2005
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_045518.1
NBCI Gene record:
Cldnd1 (224250)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_045518.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146505 CCGGAAAGAGTACACCTTAAT pLKO.1 775 3UTR 100% 13.200 18.480 N CLDND1 n/a
2 TRCN0000352823 CCGGAAAGAGTACACCTTAAT pLKO_005 775 3UTR 100% 13.200 18.480 N CLDND1 n/a
3 TRCN0000175111 GAAAGAGTACACCTTAATGAA pLKO.1 778 3UTR 100% 5.625 7.875 N Cldnd1 n/a
4 TRCN0000292788 GAAAGAGTACACCTTAATGAA pLKO_005 778 3UTR 100% 5.625 7.875 N Cldnd1 n/a
5 TRCN0000176273 CAACGATGTTCTGTTCCGATA pLKO.1 385 3UTR 100% 4.050 5.670 N Cldnd1 n/a
6 TRCN0000292787 CAACGATGTTCTGTTCCGATA pLKO_005 385 3UTR 100% 4.050 5.670 N Cldnd1 n/a
7 TRCN0000174466 CAGAGTCATTTGATGTGGTTA pLKO.1 483 3UTR 100% 4.950 3.960 N Cldnd1 n/a
8 TRCN0000292714 CAGAGTCATTTGATGTGGTTA pLKO_005 483 3UTR 100% 4.950 3.960 N Cldnd1 n/a
9 TRCN0000216738 GTTCTAGCTGAGTACTATATG pLKO.1 1628 3UTR 100% 13.200 9.240 N Cldnd1 n/a
10 TRCN0000174740 GCAGTAACTATGAAACTAGAA pLKO.1 1154 3UTR 100% 4.950 3.465 N Cldnd1 n/a
11 TRCN0000292715 GCAGTAACTATGAAACTAGAA pLKO_005 1154 3UTR 100% 4.950 3.465 N Cldnd1 n/a
12 TRCN0000193972 GCTTGTGTGCTTAGTCTGATT pLKO.1 227 3UTR 100% 4.950 3.465 N Cldnd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_045518.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03731 pDONR223 100% 24.9% None (many diffs) n/a
2 ccsbBroad304_03731 pLX_304 0% 24.9% V5 (many diffs) n/a
3 TRCN0000465354 TGCGAGTGCCCGGAAGGCCCCTTA pLX_317 46.3% 24.9% V5 (many diffs) n/a
Download CSV