Transcript: Human NR_045566.1

Homo sapiens Bardet-Biedl syndrome 4 (BBS4), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-02-06
Taxon:
Homo sapiens (human)
Gene:
BBS4 (585)
Length:
2828
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_045566.1
NBCI Gene record:
BBS4 (585)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_045566.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006724 GCATTGATATTTCGCCTAGAA pLKO.1 582 3UTR 100% 4.950 6.930 N BBS4 n/a
2 TRCN0000006723 CCTGGATAAGTGTAACCCTTT pLKO.1 1460 3UTR 100% 4.050 5.670 N BBS4 n/a
3 TRCN0000006725 GCACCCTTCGATTGGAAGATT pLKO.1 1260 3UTR 100% 5.625 7.313 N BBS4 n/a
4 TRCN0000417110 ACCTAGGAGTTTGCTACATAT pLKO_005 781 3UTR 100% 13.200 10.560 N BBS4 n/a
5 TRCN0000250504 CTGGATAAGTGTAACCCTTTA pLKO_005 1461 3UTR 100% 10.800 8.640 N Bbs4 n/a
6 TRCN0000418255 GCACGATCTGACTTATATAAT pLKO_005 860 3UTR 100% 15.000 10.500 N BBS4 n/a
7 TRCN0000429274 TAGTCCTCAGAGTGCTGATAA pLKO_005 650 3UTR 100% 13.200 9.240 N BBS4 n/a
8 TRCN0000418763 TGACCAATCTGGAAGATATAG pLKO_005 1405 3UTR 100% 13.200 9.240 N BBS4 n/a
9 TRCN0000006722 CCTCAGGTTGTGAGGTTTATT pLKO.1 2348 3UTR 100% 1.500 1.050 N BBS4 n/a
10 TRCN0000006726 GCTGTTATCAAAGAACAGCTT pLKO.1 519 3UTR 100% 0.264 0.185 N BBS4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_045566.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05878 pDONR223 100% 54.7% None (many diffs) n/a
2 ccsbBroad304_05878 pLX_304 0% 54.7% V5 (many diffs) n/a
3 TRCN0000468273 GAGCCCACTTCAGATTCCTACTGT pLX_317 28% 54.7% V5 (many diffs) n/a
Download CSV