Transcript: Mouse NR_045594.1

Mus musculus solute carrier family 12, member 4 (Slc12a4), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2016-09-04
Taxon:
Mus musculus (mouse)
Gene:
Slc12a4 (20498)
Length:
3809
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_045594.1
NBCI Gene record:
Slc12a4 (20498)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_045594.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350038 GTGAGGGTTGATACGGGATTT pLKO_005 3559 3UTR 100% 10.800 15.120 N Slc12a4 n/a
2 TRCN0000350036 GGGCAAGCTTGTCAGCTATAC pLKO_005 325 3UTR 100% 10.800 8.640 N Slc12a4 n/a
3 TRCN0000068334 CGTGCCTGGAAGACCTTTATT pLKO.1 2475 3UTR 100% 15.000 10.500 N Slc12a4 n/a
4 TRCN0000350087 ACGTGCCTGGAAGACCTTTAT pLKO_005 2474 3UTR 100% 13.200 9.240 N Slc12a4 n/a
5 TRCN0000068335 CTTGAATAACATGAGAGTGTA pLKO.1 817 3UTR 100% 4.950 3.465 N Slc12a4 n/a
6 TRCN0000068333 GCAGACCATCAAGAACATGAT pLKO.1 2297 3UTR 100% 4.950 3.465 N Slc12a4 n/a
7 TRCN0000042935 CCAGTTTGACATCTGTGCCAA pLKO.1 1030 3UTR 100% 2.640 1.848 N SLC12A4 n/a
8 TRCN0000232783 AGATCTTGCTGACCTACATTG pLKO_005 741 3UTR 100% 10.800 6.480 N SLC12A4 n/a
9 TRCN0000350052 AGATCTTGCTGACCTACATTG pLKO_005 741 3UTR 100% 10.800 6.480 N Slc12a4 n/a
10 TRCN0000068337 CAGGGTAACCACAGAGAGAAT pLKO.1 194 3UTR 100% 4.950 2.970 N Slc12a4 n/a
11 TRCN0000317864 CAGGGTAACCACAGAGAGAAT pLKO_005 194 3UTR 100% 4.950 2.970 N Slc12a4 n/a
12 TRCN0000068336 GCGACGAGAACTACATGGAAT pLKO.1 3214 3UTR 100% 4.950 2.970 N Slc12a4 n/a
13 TRCN0000042936 TGCACATTAAGCCGGACCAAT pLKO.1 3079 3UTR 100% 4.950 6.930 N SLC12A4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_045594.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06965 pDONR223 100% 75.6% None (many diffs) n/a
2 ccsbBroad304_06965 pLX_304 0% 75.6% V5 (many diffs) n/a
3 TRCN0000469900 GCAACCCAAGTTAATCTTAAGTGA pLX_317 12% 75.6% V5 (many diffs) n/a
Download CSV