Transcript: Human NR_045721.2

Homo sapiens mannosidase alpha class 1B member 1 (MAN1B1), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
MAN1B1 (11253)
Length:
2838
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_045721.2
NBCI Gene record:
MAN1B1 (11253)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_045721.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220065 GATCGTGCACTTCAACCTTTA pLKO.1 1856 3UTR 100% 10.800 15.120 N MAN1B1 n/a
2 TRCN0000220066 ACGAATCATGACTCACGATTG pLKO.1 2489 3UTR 100% 6.000 8.400 N MAN1B1 n/a
3 TRCN0000149591 CATGGAGACTTGTTACCAGAT pLKO.1 1802 3UTR 100% 4.050 3.240 N MAN1B1 n/a
4 TRCN0000180067 CCTCCTCGTCTCTGCTTTAAT pLKO.1 2375 3UTR 100% 15.000 10.500 N MAN1B1 n/a
5 TRCN0000220064 GACCACCTCACCTGCAGATTA pLKO.1 637 3UTR 100% 13.200 9.240 N MAN1B1 n/a
6 TRCN0000179225 GCCAGAAATTGCTGGGTTAAA pLKO.1 512 3UTR 100% 13.200 9.240 N MAN1B1 n/a
7 TRCN0000183043 CGAAGAAGTTACACTTTGAAA pLKO.1 1090 3UTR 100% 5.625 3.938 N MAN1B1 n/a
8 TRCN0000148852 CCTGAGAACTTACCTGAGATT pLKO.1 582 3UTR 100% 4.950 3.465 N MAN1B1 n/a
9 TRCN0000149436 GCAGCGGAATATGATTCTCTT pLKO.1 258 3UTR 100% 4.950 3.465 N MAN1B1 n/a
10 TRCN0000149502 GCTCAAGTATCTGTTCTTGCT pLKO.1 2138 3UTR 100% 2.640 1.848 N MAN1B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_045721.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07788 pDONR223 100% 73.8% None (many diffs) n/a
2 ccsbBroad304_07788 pLX_304 0% 73.8% V5 (many diffs) n/a
3 TRCN0000471160 CCATGGCCCAACTCTGGGTTATTA pLX_317 23% 73.8% V5 (many diffs) n/a
4 ccsbBroadEn_07787 pDONR223 100% 73.8% None (many diffs) n/a
5 ccsbBroad304_07787 pLX_304 0% 73.8% V5 (many diffs) n/a
6 TRCN0000474802 ACTCTTCATACAGTGTCCCGAGAG pLX_317 19.1% 73.8% V5 (many diffs) n/a
Download CSV