Transcript: Human NR_046322.1

Homo sapiens STARD7 antisense RNA 1 (STARD7-AS1), long non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
STARD7-AS1 (285033)
Length:
2484
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_046322.1
NBCI Gene record:
STARD7-AS1 (285033)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_046322.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163479 GTTCCTCGTAGCAGGTAATTT pLKO.1 1421 3UTR 100% 15.000 21.000 N STARD7-AS1 n/a
2 TRCN0000163199 GAATTGCAAGGCCAAAGACAT pLKO.1 1507 3UTR 100% 4.950 3.960 N STARD7-AS1 n/a
3 TRCN0000164566 CCTCGTAGCAGGTAATTTCTT pLKO.1 1424 3UTR 100% 5.625 3.938 N STARD7-AS1 n/a
4 TRCN0000166434 CAAAGACATCTCGGGTCAACT pLKO.1 1519 3UTR 100% 4.950 3.465 N STARD7-AS1 n/a
5 TRCN0000165985 GCCAGTGAGAACACACATTCA pLKO.1 1563 3UTR 100% 4.950 3.465 N STARD7-AS1 n/a
6 TRCN0000437486 AGCCTAGGAAGCAAAGTGAAG pLKO_005 1681 3UTR 100% 4.050 2.835 N STARD7-AS1 n/a
7 TRCN0000166028 CAACTCTTCTCAGGACCAGAT pLKO.1 1535 3UTR 100% 4.050 2.835 N STARD7-AS1 n/a
8 TRCN0000436408 AGATCCAAGTCGCCAGTGAGA pLKO_005 1552 3UTR 100% 2.640 1.848 N STARD7-AS1 n/a
9 TRCN0000433090 TGCTTCATGTGGGCAAGAGCT pLKO_005 1625 3UTR 100% 2.640 1.848 N STARD7-AS1 n/a
10 TRCN0000163140 GTAGCAGGTAATTTCTTCCGA pLKO.1 1428 3UTR 100% 0.750 0.525 N STARD7-AS1 n/a
11 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 1807 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_046322.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05388 pDONR223 100% 14.6% None 1_1370del;1734_2484del n/a
2 ccsbBroad304_05388 pLX_304 0% 14.6% V5 1_1370del;1734_2484del n/a
3 TRCN0000479956 GTAACGCGGAAGTATATAACCACT pLX_317 87.5% 14.6% V5 1_1370del;1734_2484del n/a
Download CSV