Transcript: Human NR_046342.2

Homo sapiens ubiquitin specific peptidase 3 (USP3), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
USP3 (9960)
Length:
5633
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_046342.2
NBCI Gene record:
USP3 (9960)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_046342.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000320690 GTTGATACATACGTAGAATTT pLKO_005 1533 3UTR 100% 13.200 18.480 N USP3 n/a
2 TRCN0000320691 TACTGTTGTCACGGCTATATT pLKO_005 1184 3UTR 100% 15.000 10.500 N USP3 n/a
3 TRCN0000007604 GCTGCCTTTCCACAGCTATAA pLKO.1 2219 3UTR 100% 13.200 9.240 N USP3 n/a
4 TRCN0000320763 GCTGCCTTTCCACAGCTATAA pLKO_005 2219 3UTR 100% 13.200 9.240 N USP3 n/a
5 TRCN0000007606 CCAACCATAAGAAATCAGAAA pLKO.1 469 3UTR 100% 4.950 3.465 N USP3 n/a
6 TRCN0000320694 CCAACCATAAGAAATCAGAAA pLKO_005 469 3UTR 100% 4.950 3.465 N USP3 n/a
7 TRCN0000007605 GCCTCATATGTGGGACAGAAT pLKO.1 1234 3UTR 100% 0.000 0.000 N USP3 n/a
8 TRCN0000320688 GCCTCATATGTGGGACAGAAT pLKO_005 1234 3UTR 100% 0.000 0.000 N USP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_046342.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02275 pDONR223 100% 27.6% None 1_147del;298_413del;1824_5633del n/a
2 ccsbBroad304_02275 pLX_304 0% 27.6% V5 1_147del;298_413del;1824_5633del n/a
3 TRCN0000469117 AATTGGACTGAGCGCTCAGCCACA pLX_317 23.7% 27.6% V5 1_147del;298_413del;1824_5633del n/a
Download CSV