Transcript: Human NR_046408.2

Homo sapiens fructosamine 3 kinase related protein (FN3KRP), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
FN3KRP (79672)
Length:
1950
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_046408.2
NBCI Gene record:
FN3KRP (79672)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_046408.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052552 CAAGGACGAGTGTTCGTGAAA pLKO.1 153 3UTR 100% 4.950 6.930 N FN3KRP n/a
2 TRCN0000174174 CAAGGACGAGTGTTCGTGAAA pLKO.1 153 3UTR 100% 4.950 6.930 N FN3KRP n/a
3 TRCN0000052549 CTCGGAATATGAGCTGGCAAT pLKO.1 901 3UTR 100% 4.050 5.670 N FN3KRP n/a
4 TRCN0000052551 CTTGAACCACTGGAATCATTT pLKO.1 1033 3UTR 100% 13.200 9.240 N FN3KRP n/a
5 TRCN0000199718 GTATGAGCAGAGGGATGTATG pLKO.1 1326 3UTR 100% 10.800 7.560 N FN3KRP n/a
6 TRCN0000052548 TGGCCGATTTACACCTTGATA pLKO.1 498 3UTR 100% 5.625 3.938 N FN3KRP n/a
7 TRCN0000194844 CAATTCCAGAATCAAGCGTAT pLKO.1 1608 3UTR 100% 4.050 2.835 N FN3KRP n/a
8 TRCN0000052550 CGGAGCTACGACACGGATCAA pLKO.1 135 3UTR 100% 1.650 1.155 N FN3KRP n/a
9 TRCN0000174173 CGGAGCTACGACACGGATCAA pLKO.1 135 3UTR 100% 1.650 1.155 N FN3KRP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_046408.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04105 pDONR223 100% 47.4% None (many diffs) n/a
2 ccsbBroad304_04105 pLX_304 0% 47.4% V5 (many diffs) n/a
3 TRCN0000472673 TAGCCTAGTGAACTATCGACAGGA pLX_317 39% 47.4% V5 (many diffs) n/a
4 ccsbBroadEn_15149 pDONR223 0% 47.4% None (many diffs) n/a
5 ccsbBroad304_15149 pLX_304 0% 47.4% V5 (many diffs) n/a
6 TRCN0000474190 GTAATTAAAGATTTTCAGTGGGGG pLX_317 44.3% 47.4% V5 (many diffs) n/a
Download CSV