Transcript: Human NR_051958.3

Homo sapiens ADP ribosylation factor related protein 1 (ARFRP1), transcript variant 13, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ARFRP1 (10139)
Length:
2442
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_051958.3
NBCI Gene record:
ARFRP1 (10139)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_051958.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303688 ACGGCGTCATCTACGTCATTG pLKO_005 392 3UTR 100% 10.800 15.120 N ARFRP1 n/a
2 TRCN0000047759 CCGATTTAACAAGAACTACAA pLKO.1 228 3UTR 100% 4.950 6.930 N ARFRP1 n/a
3 TRCN0000310740 TGAGTCCAAGCAGGCGTTTGA pLKO_005 438 3UTR 100% 4.950 6.930 N ARFRP1 n/a
4 TRCN0000380523 CACCACCGTGGGCCTAAACAT pLKO_005 273 3UTR 100% 1.875 2.625 N ARFRP1 n/a
5 TRCN0000380613 GTCTTTGTGGGACAAGTATTA pLKO_005 360 3UTR 100% 13.200 9.240 N ARFRP1 n/a
6 TRCN0000047761 CCTCTCAATCCCTGACATCAA pLKO.1 463 3UTR 100% 4.950 3.465 N ARFRP1 n/a
7 TRCN0000310423 CCTCTCAATCCCTGACATCAA pLKO_005 463 3UTR 100% 4.950 3.465 N ARFRP1 n/a
8 TRCN0000047758 CGAAGACAAACTTTCCTCTAT pLKO.1 778 3UTR 100% 4.950 3.465 N ARFRP1 n/a
9 TRCN0000299575 CGAAGACAAACTTTCCTCTAT pLKO_005 778 3UTR 100% 4.950 3.465 N ARFRP1 n/a
10 TRCN0000047762 CGGCTCATGTTCTGGGACTTA pLKO.1 319 3UTR 100% 4.950 3.465 N ARFRP1 n/a
11 TRCN0000047760 GCAGTCTTTGTGGGACAAGTA pLKO.1 357 3UTR 100% 4.950 3.465 N ARFRP1 n/a
12 TRCN0000379806 CAATGCTGGGAAGACGACCTT pLKO_005 189 3UTR 100% 2.640 1.848 N ARFRP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_051958.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07562 pDONR223 100% 21.1% None 1_111del;456_457ins71;644_2442del n/a
2 ccsbBroad304_07562 pLX_304 0% 21.1% V5 (not translated due to frame shift) 1_111del;456_457ins71;644_2442del n/a
3 TRCN0000476314 GAACCTTCATTTATCTTCGGGCAG pLX_317 46.5% 21.1% V5 (not translated due to prior stop codon) 1_111del;456_457ins71;644_2442del n/a
Download CSV