Transcript: Human NR_051978.2

Homo sapiens TBC1 domain family member 2 (TBC1D2), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
TBC1D2 (55357)
Length:
3123
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_051978.2
NBCI Gene record:
TBC1D2 (55357)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_051978.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248868 AGACTCCCAGCCGGGTTATTA pLKO_005 449 3UTR 100% 15.000 21.000 N Tbc1d2 n/a
2 TRCN0000437191 AGACTCCCAGCCGGGTTATTA pLKO_005 449 3UTR 100% 15.000 21.000 N TBC1D2 n/a
3 TRCN0000431704 GATGCTCACCAAGGAGTTAAA pLKO_005 914 3UTR 100% 13.200 18.480 N TBC1D2 n/a
4 TRCN0000430464 AGGAAATGTCAGCTGTATTAC pLKO_005 328 3UTR 100% 13.200 9.240 N TBC1D2 n/a
5 TRCN0000416895 AGTGCAGTGTTTGACTGTAAG pLKO_005 397 3UTR 100% 10.800 7.560 N TBC1D2 n/a
6 TRCN0000178781 CATCGCCTTCAATGACATGAA pLKO.1 2558 3UTR 100% 4.950 3.465 N TBC1D2 n/a
7 TRCN0000416858 GACCATCAGTTTCGCTCAGAA pLKO_005 794 3UTR 100% 4.950 3.465 N TBC1D2 n/a
8 TRCN0000181129 CTTCACCAAGACCATCTCCAA pLKO.1 2519 3UTR 100% 2.640 1.848 N TBC1D2 n/a
9 TRCN0000180592 GAAGCTGATGAACATCGCCTT pLKO.1 2546 3UTR 100% 2.160 1.512 N TBC1D2 n/a
10 TRCN0000183799 CATCAGTAAGTATGATGAGTA pLKO.1 1634 3UTR 100% 0.495 0.347 N TBC1D2 n/a
11 TRCN0000248871 GTGGGTATTTAAGTAAGTTTG pLKO_005 254 3UTR 100% 10.800 7.560 N Tbc1d2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_051978.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12212 pDONR223 100% 44.9% None 1_1346del;1718A>G;2751_3123del n/a
2 ccsbBroad304_12212 pLX_304 0% 44.9% V5 1_1346del;1718A>G;2751_3123del n/a
3 TRCN0000474709 GAATAAACCAGACAGCCCTTCGGC pLX_317 41.2% 44.9% V5 1_1346del;1718A>G;2751_3123del n/a
Download CSV