Transcript: Human NR_051991.1

Homo sapiens SUMO specific peptidase 1 (SENP1), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
SENP1 (29843)
Length:
5134
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_051991.1
NBCI Gene record:
SENP1 (29843)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_051991.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414145 CCAGCATATACATGGACATAC pLKO_005 3125 3UTR 100% 10.800 15.120 N SENP1 n/a
2 TRCN0000414605 GTGAACCACAACTCCGTATTC pLKO_005 687 3UTR 100% 10.800 15.120 N SENP1 n/a
3 TRCN0000004398 CCGAAAGACCTCAAGTGGATT pLKO.1 1132 3UTR 100% 4.950 6.930 N SENP1 n/a
4 TRCN0000004399 GCGCCAGATTGAAGAACAGAA pLKO.1 1837 3UTR 100% 4.950 6.930 N SENP1 n/a
5 TRCN0000004396 CGAGAAAGATTGCGCCAGATT pLKO.1 1826 3UTR 100% 4.950 3.960 N SENP1 n/a
6 TRCN0000436637 ACAAGAAGTGCAGCTTATAAT pLKO_005 819 3UTR 100% 15.000 10.500 N SENP1 n/a
7 TRCN0000436022 ATGCTGATGGAGCGAAGTAAA pLKO_005 2195 3UTR 100% 13.200 9.240 N SENP1 n/a
8 TRCN0000004397 TGACCATTACACGCAAAGATA pLKO.1 2115 3UTR 100% 5.625 3.938 N SENP1 n/a
9 TRCN0000004395 CTCGATGTCTTAGTTCCAGTA pLKO.1 1425 3UTR 100% 4.050 2.835 N SENP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_051991.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11906 pDONR223 100% 37.5% None (many diffs) n/a
2 ccsbBroad304_11906 pLX_304 0% 37.5% V5 (many diffs) n/a
3 TRCN0000479266 TGCATCGCTTTAGCTGCGGAATCT pLX_317 12.4% 37.5% V5 (many diffs) n/a
Download CSV