Transcript: Human NR_070308.1

Homo sapiens DPY30 domain containing 2 (DYDC2), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-02-06
Taxon:
Homo sapiens (human)
Gene:
DYDC2 (84332)
Length:
2270
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_070308.1
NBCI Gene record:
DYDC2 (84332)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_070308.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000145553 CAGATTGACCAGAACTTCAAA pLKO.1 1028 3UTR 100% 5.625 3.938 N DYDC2 n/a
2 TRCN0000121769 CAGGAAGAGTATCAGATTCAA pLKO.1 824 3UTR 100% 5.625 3.938 N DYDC2 n/a
3 TRCN0000121561 CAGATTCAACAGAACTGTGAA pLKO.1 836 3UTR 100% 4.950 3.465 N DYDC2 n/a
4 TRCN0000144888 GAAACAGGAAGAGTATCAGAT pLKO.1 820 3UTR 100% 4.950 3.465 N DYDC2 n/a
5 TRCN0000142609 GATTCCAGGAATGCCTCAACA pLKO.1 982 3UTR 100% 4.950 3.465 N DYDC2 n/a
6 TRCN0000141084 CAGTAGCCTCAAGGAAATGGA pLKO.1 784 3UTR 100% 3.000 2.100 N DYDC2 n/a
7 TRCN0000142793 CAATAGAATACCTGGCTCACT pLKO.1 684 3UTR 100% 2.640 1.848 N DYDC2 n/a
8 TRCN0000143765 CACAAGGAACTGACTTCTGAA pLKO.1 863 3UTR 100% 4.950 2.970 N DYDC2 n/a
9 TRCN0000141323 CCATATTCATGCAGGAGGACA pLKO.1 903 3UTR 100% 2.640 1.584 N DYDC2 n/a
10 TRCN0000136835 CACCATGTAAGAAGTGCCTTT pLKO.1 7 3UTR 100% 4.050 2.025 Y C7orf69 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_070308.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04382 pDONR223 100% 23.3% None 1_598del;1130_2270del n/a
2 ccsbBroad304_04382 pLX_304 0% 23.3% V5 1_598del;1130_2270del n/a
3 TRCN0000474541 TTTATCAGGATCAGTTTGGACCCC pLX_317 67.6% 23.3% V5 1_598del;1130_2270del n/a
Download CSV