Transcript: Human NR_073138.1

Homo sapiens MYC associated factor X (MAX), transcript variant 10, non-coding RNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
MAX (4149)
Length:
856
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073138.1
NBCI Gene record:
MAX (4149)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_073138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304477 ACGTAGGGACCACATCAAAGA pLKO_005 226 3UTR 100% 4.950 6.930 N Max n/a
2 TRCN0000231548 GACAAACGGGCTCATCATAAT pLKO_005 191 3UTR 100% 13.200 9.240 N MAX n/a
3 TRCN0000039867 GACCACATCAAAGACAGCTTT pLKO.1 233 3UTR 100% 4.950 3.465 N MAX n/a
4 TRCN0000010374 CATCATAATGCACTGGAACGA pLKO.1 203 3UTR 100% 2.640 1.848 N MAX n/a
5 TRCN0000039865 GCTCATCATAATGCACTGGAA pLKO.1 200 3UTR 100% 2.640 1.848 N MAX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00977 pDONR223 100% 30.8% None (many diffs) n/a
2 ccsbBroad304_00977 pLX_304 0% 30.8% V5 (many diffs) n/a
3 TRCN0000471511 CTCATGCCCAAAAATTGGGTAACG pLX_317 100% 30.8% V5 (many diffs) n/a
Download CSV