Transcript: Human NR_073404.1

Homo sapiens POM121 membrane glycoprotein (rat) pseudogene (LOC441081), non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
LOC441081 (441081)
Length:
5287
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073404.1
NBCI Gene record:
LOC441081 (441081)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_073404.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166600 CCAGAGGTCAGAAGTGAGATA pLKO.1 2322 3UTR 100% 4.950 2.475 Y LOC729915 n/a
2 TRCN0000166305 CCCAGAGCTCAGAAATCAGAT pLKO.1 1385 3UTR 100% 4.950 2.475 Y LOC729915 n/a
3 TRCN0000164983 GCTGACCCTCAGTTACTCAAA pLKO.1 1536 3UTR 100% 4.950 2.475 Y LOC729915 n/a
4 TRCN0000163867 CCTCAGTTACTCAAAGACAGT pLKO.1 1542 3UTR 100% 2.640 1.320 Y LOC729915 n/a
5 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 221 3UTR 100% 10.800 5.400 Y CD3EAP n/a
6 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 221 3UTR 100% 10.800 5.400 Y MRPS16 n/a
7 TRCN0000162854 CTACTCAATGCAGTGGATGAA pLKO.1 2257 3UTR 100% 4.950 2.475 Y LOC729915 n/a
8 TRCN0000166659 CGAGCACCAAACGAAATGCTA pLKO.1 1439 3UTR 100% 3.000 1.500 Y LOC729915 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073404.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10587 pDONR223 100% 22.2% None (many diffs) n/a
2 ccsbBroad304_10587 pLX_304 0% 22.2% V5 (many diffs) n/a
3 TRCN0000472538 GCTGGAAACCAGACTTGAAGCAAA pLX_317 39.6% 22.2% V5 (many diffs) n/a
Download CSV