Transcript: Mouse NR_073583.1

Mus musculus protein phosphatase 2, regulatory subunit B, beta (Ppp2r2b), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Ppp2r2b (72930)
Length:
2531
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_073583.1
NBCI Gene record:
Ppp2r2b (72930)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_073583.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071490 GCGGCTACGAATAACTTATAT pLKO.1 1980 3UTR 100% 15.000 21.000 N Ppp2r2b n/a
2 TRCN0000071491 CCCGAGTTCGATTACCTGAAA pLKO.1 924 3UTR 100% 4.950 6.930 N Ppp2r2b n/a
3 TRCN0000413642 GTGTTGACAGTCTGGACTTTA pLKO_005 1906 3UTR 100% 13.200 9.240 N Ppp2r2b n/a
4 TRCN0000071492 CCACTGCAACACCTTCGTATA pLKO.1 1391 3UTR 100% 10.800 7.560 N Ppp2r2b n/a
5 TRCN0000441014 GAAAGTCAGTGAGCGGGATAA pLKO_005 1046 3UTR 100% 10.800 7.560 N Ppp2r2b n/a
6 TRCN0000018341 GACATTATCTCTACGGTAGAA pLKO.1 765 3UTR 100% 4.950 3.465 N PPP2R2B n/a
7 TRCN0000294422 GACATTATCTCTACGGTAGAA pLKO_005 765 3UTR 100% 4.950 3.465 N PPP2R2B n/a
8 TRCN0000071488 GCTACTACTTAGTCTCACATA pLKO.1 2033 3UTR 100% 4.950 3.465 N Ppp2r2b n/a
9 TRCN0000040170 GCTGACATTATCTCTACGGTA pLKO.1 762 3UTR 100% 2.640 1.848 N PPP2R2B n/a
10 TRCN0000040172 CTTACTTTCTTCTGTCTACTA pLKO.1 1003 3UTR 100% 4.950 3.465 N PPP2R2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_073583.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01264 pDONR223 100% 49.5% None (many diffs) n/a
2 ccsbBroad304_01264 pLX_304 0% 49.5% V5 (many diffs) n/a
3 TRCN0000469328 ACGCTCCCCGTTCAGGGCGGTTCC pLX_317 35.1% 49.5% V5 (many diffs) n/a
Download CSV