Transcript: Human NR_075070.1

Homo sapiens stathmin 3 (STMN3), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2018-06-03
Taxon:
Homo sapiens (human)
Gene:
STMN3 (50861)
Length:
2538
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_075070.1
NBCI Gene record:
STMN3 (50861)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_075070.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438396 CGACAGAACACGTTCGGGTTT pLKO_005 934 3UTR 100% 4.050 5.670 N STMN3 n/a
2 TRCN0000418081 CCTCTGTCTAGATGCAACTTT pLKO_005 972 3UTR 100% 5.625 3.938 N STMN3 n/a
3 TRCN0000063856 CGCTGGAGGAGAATAACAACT pLKO.1 724 3UTR 100% 4.950 3.465 N STMN3 n/a
4 TRCN0000447448 CCCAATACCGTCTACCAGTAC pLKO_005 356 3UTR 100% 4.050 2.835 N STMN3 n/a
5 TRCN0000063854 CTACAAGATGGAGCTCAGCAA pLKO.1 773 3UTR 100% 2.640 1.848 N STMN3 n/a
6 TRCN0000184270 GCTCAACTACAAGATGGAGCT pLKO.1 767 3UTR 100% 2.160 1.512 N Stmn3 n/a
7 TRCN0000063855 GTCGCTCATCTGCTCCTGCTT pLKO.1 319 3UTR 100% 0.880 0.616 N STMN3 n/a
8 TRCN0000063853 GCGAGAAGAGATGTCGGGCTA pLKO.1 884 3UTR 100% 0.720 0.504 N STMN3 n/a
9 TRCN0000063857 CCTCCCTGGAGGAGCTGCAAA pLKO.1 504 3UTR 100% 0.000 0.000 N STMN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_075070.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03160 pDONR223 100% 21.2% None 1_265del;556_652del;903_2538del n/a
2 ccsbBroad304_03160 pLX_304 0% 21.2% V5 1_265del;556_652del;903_2538del n/a
3 TRCN0000471016 TTACCCTGTGGCAGGCATAGTCTG pLX_317 66.7% 21.2% V5 1_265del;556_652del;903_2538del n/a
Download CSV