Transcript: Mouse NR_075104.1

Mus musculus electron transferring flavoprotein, beta polypeptide (Etfb), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Etfb (110826)
Length:
919
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_075104.1
NBCI Gene record:
Etfb (110826)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_075104.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265312 CGCTGTGAAGATTCGGGTAAA pLKO_005 124 3UTR 100% 10.800 8.640 N Etfb n/a
2 TRCN0000064429 GCCCAACATCATGAAAGCCAA pLKO.1 660 3UTR 100% 2.640 2.112 N ETFB n/a
3 TRCN0000291085 GCCCAACATCATGAAAGCCAA pLKO_005 660 3UTR 100% 2.640 2.112 N ETFB n/a
4 TRCN0000250622 CTGCTGACCTAAGGCTCAATG pLKO_005 620 3UTR 100% 10.800 7.560 N Etfb n/a
5 TRCN0000250623 GCTATTGATGATGACTGTAAC pLKO_005 452 3UTR 100% 10.800 7.560 N Etfb n/a
6 TRCN0000250621 AGTGGTCACTGATGGTGTGAA pLKO_005 160 3UTR 100% 4.950 3.465 N Etfb n/a
7 TRCN0000195772 CTGTAACCAGACAGGTCAGAT pLKO.1 466 3UTR 100% 4.950 3.465 N Etfb n/a
8 TRCN0000064432 TGGTGTGAAGCACTCCATGAA pLKO.1 172 3UTR 100% 4.950 3.465 N ETFB n/a
9 TRCN0000291142 TGGTGTGAAGCACTCCATGAA pLKO_005 172 3UTR 100% 4.950 3.465 N ETFB n/a
10 TRCN0000250620 CCAAGAAGAAGAAGATTGAAG pLKO_005 677 3UTR 100% 4.950 2.970 N Etfb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_075104.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00519 pDONR223 100% 72.8% None (many diffs) n/a
2 ccsbBroad304_00519 pLX_304 0% 72.8% V5 (many diffs) n/a
3 TRCN0000476333 AATCATCTTCAATAAGTCTGTACC pLX_317 41.3% 72.8% V5 (many diffs) n/a
Download CSV