Transcript: Mouse NR_102339.1

Mus musculus anoctamin 4 (Ano4), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Ano4 (320091)
Length:
4134
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_102339.1
NBCI Gene record:
Ano4 (320091)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_102339.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248383 GAACTTGGCTACCCGTTAATT pLKO_005 2449 3UTR 100% 15.000 21.000 N Ano4 n/a
2 TRCN0000248385 GGATCTTGTCAGGCGATATTT pLKO_005 1464 3UTR 100% 15.000 21.000 N Ano4 n/a
3 TRCN0000248382 CCGAGCAAGCATGCACGTTAT pLKO_005 3562 3UTR 100% 10.800 15.120 N Ano4 n/a
4 TRCN0000190752 GCTGTAAACCACCGACATCTA pLKO.1 1393 3UTR 100% 4.950 6.930 N Ano4 n/a
5 TRCN0000248384 TTCATGAGCAGGATCGATAAA pLKO_005 1048 3UTR 100% 13.200 10.560 N Ano4 n/a
6 TRCN0000167227 CACTTCATCATACACAACAAA pLKO.1 1189 3UTR 100% 5.625 3.938 N ANO4 n/a
7 TRCN0000190554 GCTTTCAGACAGCTGTGTCTA pLKO.1 1680 3UTR 100% 0.495 0.347 N Ano4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_102339.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13086 pDONR223 100% 59.9% None (many diffs) n/a
2 ccsbBroad304_13086 pLX_304 0% 59.9% V5 (many diffs) n/a
3 TRCN0000466450 CCACAAACCCTCTGGAGTAGCACA pLX_317 14.4% 59.9% V5 (many diffs) n/a
Download CSV