Transcript: Human NR_103529.2

Homo sapiens CLK4 associating serine/arginine rich protein (CLASRP), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
CLASRP (11129)
Length:
2233
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_103529.2
NBCI Gene record:
CLASRP (11129)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_103529.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075090 CCCGATACAGTCGAGAATACA pLKO.1 2046 3UTR 100% 5.625 7.875 N CLASRP n/a
2 TRCN0000075091 GCGGAGAGAGTTTCGGGAGAA pLKO.1 903 3UTR 100% 1.350 1.890 N CLASRP n/a
3 TRCN0000298170 GCGGAGAGAGTTTCGGGAGAA pLKO_005 903 3UTR 100% 1.350 1.890 N CLASRP n/a
4 TRCN0000298545 GAGCGGAGACGGGAGTATTAT pLKO_005 163 3UTR 100% 15.000 10.500 N CLASRP n/a
5 TRCN0000293730 AGAAGGCTTCCATCGGTTATA pLKO_005 569 3UTR 100% 13.200 9.240 N CLASRP n/a
6 TRCN0000075088 CCAGATCTACATTGATGAGTT pLKO.1 495 3UTR 100% 4.950 3.465 N CLASRP n/a
7 TRCN0000075089 CAACAACATGATTGACCGATT pLKO.1 312 3UTR 100% 4.050 2.835 N CLASRP n/a
8 TRCN0000286220 CAACAACATGATTGACCGATT pLKO_005 312 3UTR 100% 4.050 2.835 N CLASRP n/a
9 TRCN0000075092 CCGCGAGGAGAAGATCACGTT pLKO.1 1056 3UTR 100% 0.880 0.616 N CLASRP n/a
10 TRCN0000286219 CCGCGAGGAGAAGATCACGTT pLKO_005 1056 3UTR 100% 0.880 0.616 N CLASRP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_103529.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11599 pDONR223 100% 27% None 1_138del;594_1252del;1401_2233del n/a
2 ccsbBroad304_11599 pLX_304 0% 27% V5 1_138del;594_1252del;1401_2233del n/a
3 TRCN0000473824 GGGCTTCATTACTAATACTCACGT pLX_317 73% 26.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV