Transcript: Human NR_103717.1

Homo sapiens long intergenic non-protein coding RNA 1561 (LINC01561), long non-coding RNA.

Source:
NCBI, updated 2019-04-21
Taxon:
Homo sapiens (human)
Gene:
LINC01561 (404216)
Length:
2186
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_103717.1
NBCI Gene record:
LINC01561 (404216)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_103717.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178912 CCGGAATTTGAATCCTGCAAT pLKO.1 1631 3UTR 100% 4.950 2.475 Y LINC01561 n/a
2 TRCN0000179518 GAATCTTGAGTGTCCAGATCA pLKO.1 565 3UTR 100% 4.950 2.475 Y LINC01561 n/a
3 TRCN0000183438 GCAGTGAATTTGGTTGTTCTT pLKO.1 1698 3UTR 100% 4.950 2.475 Y LINC01561 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_103717.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10633 pDONR223 100% 17.5% None 1_362del;747_2186del n/a
2 ccsbBroad304_10633 pLX_304 0% 17.5% V5 1_362del;747_2186del n/a
3 TRCN0000476315 ATCATATGGCTCCTAAATCAGCGC pLX_317 76.1% 17.5% V5 1_362del;747_2186del n/a
Download CSV