Transcript: Mouse NR_104070.1

Mus musculus protein tyrosine phosphatase, non-receptor type 22 (lymphoid) (Ptpn22), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Ptpn22 (19260)
Length:
2770
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104070.1
NBCI Gene record:
Ptpn22 (19260)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NR_104070.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029911 CCGATGAGGATTCCAGTTATA pLKO.1 385 3UTR 100% 13.200 18.480 N Ptpn22 n/a
2 TRCN0000029910 CCGTGCAAACTTCTTCTACTA pLKO.1 2279 3UTR 100% 4.950 6.930 N Ptpn22 n/a
3 TRCN0000029909 CGGCTAAATCAAGCCCTTCTT pLKO.1 1273 3UTR 100% 4.950 3.960 N Ptpn22 n/a
4 TRCN0000029912 CGGACCAAATCAACTCCCTTT pLKO.1 1497 3UTR 100% 4.050 3.240 N Ptpn22 n/a
5 TRCN0000029913 CCACATCTTCTAAACAAACAT pLKO.1 2324 3UTR 100% 5.625 3.938 N Ptpn22 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104070.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11820 pDONR223 100% 16.2% None (many diffs) n/a
2 ccsbBroad304_11820 pLX_304 0% 16.2% V5 (many diffs) n/a
3 TRCN0000469063 TGAGAAGTGGGTAGGCCCGGTTAA pLX_317 56.9% 16.2% V5 (many diffs) n/a
4 TRCN0000491802 GTTCAGTCTTTCAGAGAATAGACC pLX_317 60.2% 16.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV