Transcript: Human NR_104121.2

Homo sapiens transmembrane protein 185A (TMEM185A), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
TMEM185A (84548)
Length:
2251
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104121.2
NBCI Gene record:
TMEM185A (84548)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104121.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165111 CGCACCCATGTTTCGAAAGAA pLKO.1 697 3UTR 100% 5.625 7.875 N TMEM185A n/a
2 TRCN0000165553 GCCGGAACACTAGAGAATGTT pLKO.1 1754 3UTR 100% 5.625 7.875 N TMEM185A n/a
3 TRCN0000439626 TCTCCTGCATCCCGATCTTTG pLKO_005 465 3UTR 100% 10.800 7.560 N TMEM185A n/a
4 TRCN0000251666 TGCGCTCTATGGATGTGATTG pLKO_005 333 3UTR 100% 10.800 7.560 N Tmem185a n/a
5 TRCN0000166497 CATTGTGTGGTCCGTCTTGTT pLKO.1 310 3UTR 100% 4.950 3.465 N TMEM185A n/a
6 TRCN0000166739 CCCAGAAGGAACATCTGTCTA pLKO.1 1120 3UTR 100% 4.950 3.465 N TMEM185A n/a
7 TRCN0000159464 CGCAAAGATTTCTGTCAGTTT pLKO.1 566 3UTR 100% 4.950 3.465 N TMEM185A n/a
8 TRCN0000159980 CCTCCCAAATTAAATATCGAA pLKO.1 764 3UTR 100% 3.000 2.100 N TMEM185A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104121.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09200 pDONR223 100% 27.7% None (many diffs) n/a
2 ccsbBroad304_09200 pLX_304 0% 27.7% V5 (many diffs) n/a
3 TRCN0000469221 TTGGTGATGGAAGCTAACGGAAGT pLX_317 26.7% 27.7% V5 (many diffs) n/a
4 ccsbBroadEn_14310 pDONR223 100% 22.8% None 1_277del;791G>A;794_2251del n/a
5 ccsbBroad304_14310 pLX_304 0% 22.8% V5 1_277del;791G>A;794_2251del n/a
6 TRCN0000479165 CGTTTGGGAGTTTCCAGATCTTGG pLX_317 70.8% 22.8% V5 1_277del;791G>A;794_2251del n/a
Download CSV