Construct: ORF TRCN0000469221
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004442.1_s317c1
- Derived from:
- ccsbBroadEn_09200
- DNA Barcode:
- TTGGTGATGGAAGCTAACGGAAGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TMEM185A (84548)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469221
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84548 | TMEM185A | transmembrane protein 185A | NM_032508.4 | 100% | 100% | |
| 2 | human | 84548 | TMEM185A | transmembrane protein 185A | NM_001174092.2 | 83.1% | 83.1% | 37_38ins177 |
| 3 | human | 79134 | TMEM185B | transmembrane protein 185B | NM_024121.3 | 80.3% | 88.5% | (many diffs) |
| 4 | human | 84548 | TMEM185A | transmembrane protein 185A | NM_001282302.2 | 49.1% | 48.5% | 509_510ins25;514_515delAAinsC;519_520ins507 |
| 5 | human | 84548 | TMEM185A | transmembrane protein 185A | NR_104121.2 | 27.7% | (many diffs) | |
| 6 | mouse | 236848 | Tmem185a | transmembrane protein 185A | XM_006527981.2 | 91% | 99.7% | (many diffs) |
| 7 | mouse | 236848 | Tmem185a | transmembrane protein 185A | NM_001033328.2 | 83.4% | 91.7% | (many diffs) |
| 8 | mouse | 236848 | Tmem185a | transmembrane protein 185A | XM_017318471.1 | 68.3% | 76% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1119
- ORF length:
- 1050
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaacctgagg ggcctcttcc aggacttcaa cccgagtaaa ttcctcatct 121 atgcctgtct gctgctgttc tctgtgctgc tggcccttcg tttggatggc atcatacagt 181 ggagttactg ggctgtcttt gctccaatat ggctgtggaa gttaatggtc attgttggag 241 cctcagttgg aactggagtc tgggcacgaa atcctcaata tcgagcagaa ggagaaacgt 301 gtgtggagtt taaagccatg ttgattgcag tgggcatcca cttgctcttg ttgatgtttg 361 aagttctggt ctgtgacaga atcgagagag gaagccattt ctggctcctg gtcttcatgc 421 cgctgttctt tgtttccccg gtgtctgttg cagcttgcgt ttggggcttt cgacatgaca 481 ggtcactaga gttagaaatc ctgtgttctg tcaacattct ccagtttata ttcattgcct 541 taagactgga caagatcatc cactggccct ggcttgttgt gtgtgtcccg ctgtggattc 601 tcatgtcctt tctgtgcctg gtggtcctct actacattgt gtggtccgtc ttgttcttgc 661 gctctatgga tgtgattgcg gagcagcgca ggacacacat aaccatggcc ctgagctgga 721 tgaccatcgt cgtgcccctt cttacatttg agattctgct ggttcacaaa ctggatggcc 781 acaacgcctt ctcctgcatc ccgatctttg tccccctttg gctctcgttg atcacgctga 841 tgGCAACCAC ATTTGGACAG AAGGGAGGAA ACCACTGGTG GTTTGGTATC CGCAAAGATT 901 TCTGTCAGTT TCTGCTTGAA ATCTTCCCAT TTCTACGAGA ATATGGAAAC ATTTCCTATG 961 ATCTCCATCA CGAAGATAAT GAAGAAACCG AAGAGACCCC AGTTCCGGAG CCCCCTAAAA 1021 TCGCACCCAT GTTTCGAAAG AAGGCCAGGG TGGTCATTAC CCAGAGCCCT GGGAAGTATG 1081 TGCTCCCACC TCCCAAATTA AATATCGAAA TGCCAGATTT GCCAACTTTC TTGTACAAAG 1141 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1201 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1261 ACGATTGGTG ATGGAAGCTA ACGGAAGTAC GCGTTAAGTC gacaatcaac ctctggatta 1321 caaaatttgt gaaagatt