Transcript: Human NR_104209.2

Homo sapiens RNA polymerase III subunit F (POLR3F), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
POLR3F (10621)
Length:
2214
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_104209.2
NBCI Gene record:
POLR3F (10621)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_104209.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418655 ATGCCAACATACCCGTATTTA pLKO_005 1424 3UTR 100% 15.000 21.000 N POLR3F n/a
2 TRCN0000425651 GAAGGTGTATATGCTCTATAA pLKO_005 620 3UTR 100% 13.200 18.480 N POLR3F n/a
3 TRCN0000421447 TGCGAATTGGGAATCAGTAAG pLKO_005 840 3UTR 100% 10.800 15.120 N POLR3F n/a
4 TRCN0000052961 GATGACGATTATTGCTGCAAA pLKO.1 922 3UTR 100% 4.950 6.930 N POLR3F n/a
5 TRCN0000418497 GGGTCAGTTGGATCTCTTAAG pLKO_005 359 3UTR 100% 10.800 8.640 N POLR3F n/a
6 TRCN0000052960 CCATCAATAGGTTGTTGTCTA pLKO.1 275 3UTR 100% 4.950 3.960 N POLR3F n/a
7 TRCN0000052958 CCATCCTGAATACACTCATTT pLKO.1 885 3UTR 100% 13.200 9.240 N POLR3F n/a
8 TRCN0000052962 TCAGAATGAAATGCCTCATAT pLKO.1 231 3UTR 100% 13.200 9.240 N POLR3F n/a
9 TRCN0000423339 GTGTAGATGGACACATGAAAC pLKO_005 960 3UTR 100% 10.800 7.560 N POLR3F n/a
10 TRCN0000417536 AGGGATCCGATAACCAAGAAA pLKO_005 436 3UTR 100% 5.625 3.938 N POLR3F n/a
11 TRCN0000052959 CTGAATTTGTAGAGGTGCTTA pLKO.1 700 3UTR 100% 4.950 3.465 N POLR3F n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_104209.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07654 pDONR223 100% 42.4% None (many diffs) n/a
2 ccsbBroad304_07654 pLX_304 0% 42.4% V5 (many diffs) n/a
3 TRCN0000472647 CCACCGCACTCGCGAAACTTGGGA pLX_317 47.8% 42.4% V5 (many diffs) n/a
Download CSV